QuBi/bio203 - Revision history

imported>Weigang: /* Web Exercise 3. Predict results of PCR and restriction analysis */

2013-10-11T21:05:31Z

Web Exercise 3. Predict results of PCR and restriction analysis

← Older revision		Revision as of 21:05, 11 October 2013
Line 76:		Line 76:
	## Click "Pick Primers"		## Click "Pick Primers"
	# Identify the base location that contains 785 C/T SNP		# Identify the base location that contains 785 C/T SNP
	# Copy and paste the expected ~~302~~-bp section and locate the Fnu4H1 site using the [http://tools.neb.com/NEBcutter2/ NEBcutter website]		# Copy and paste the expected 303-bp section and locate the Fnu4H1 site using the [http://tools.neb.com/NEBcutter2/ NEBcutter website]
	# What are the expected lengths for the C/C, C/T, and T/T genotypes?		# What are the expected lengths for the C/C, C/T, and T/T genotypes?

imported>Weigang: /* Web Exercise 3. Predict results of PCR and restriction analysis */

2013-09-27T14:33:28Z

Web Exercise 3. Predict results of PCR and restriction analysis

← Older revision		Revision as of 14:33, 27 September 2013
Line 73:		Line 73:
	## Select "check_primer" in the top box, and "HUMAN" in the 2nd box		## Select "check_primer" in the top box, and "HUMAN" in the 2nd box
	## Paste the raw gene sequence into the 3rd box from the [http://www.ncbi.nlm.nih.gov/nuccore/NC_000007.13?report=fasta&from=141672259&to=141673743&strand=true GenBank page]		## Paste the raw gene sequence into the 3rd box from the [http://www.ncbi.nlm.nih.gov/nuccore/NC_000007.13?report=fasta&from=141672259&to=141673743&strand=true GenBank page]
	## Paste the two primer sequences ~~into the 4th and 6th boxes~~ (only the sequences within {}): <pre>(p2283) ttttggatccAACTGGCAGAa{TAAAGATCTCAATTTAT}; (p2285) ttttggatcc{AACACAAACCATCACCCCTATTTT}</pre>		## Paste the two primer sequences (use only the sequences within {}) into the 4th and 6th boxes: <pre>(p2283) ttttggatccAACTGGCAGAa{TAAAGATCTCAATTTAT}; (p2285) ttttggatcc{AACACAAACCATCACCCCTATTTT}</pre>
	## Click "Pick Primers"		## Click "Pick Primers"
	# Identify the base location that contains 785 C/T SNP		# Identify the base location that contains 785 C/T SNP

imported>Weigang: /* Web Exercise 3. Predict results of PCR and restriction analysis */

2013-09-27T00:51:36Z

Web Exercise 3. Predict results of PCR and restriction analysis

← Older revision		Revision as of 00:51, 27 September 2013
Line 73:		Line 73:
	## Select "check_primer" in the top box, and "HUMAN" in the 2nd box		## Select "check_primer" in the top box, and "HUMAN" in the 2nd box
	## Paste the raw gene sequence into the 3rd box from the [http://www.ncbi.nlm.nih.gov/nuccore/NC_000007.13?report=fasta&from=141672259&to=141673743&strand=true GenBank page]		## Paste the raw gene sequence into the 3rd box from the [http://www.ncbi.nlm.nih.gov/nuccore/NC_000007.13?report=fasta&from=141672259&to=141673743&strand=true GenBank page]
	## Paste the two primer sequences into the 4th and 6th boxes: <pre>(p2283) ~~ttttggatccAACTGGCAGAaTAAAGATCTCAATTTAT~~; (p2285) ~~ttttggatccAACACAAACCATCACCCCTATTTT~~</pre>		## Paste the two primer sequences into the 4th and 6th boxes (only the sequences within {}): <pre>(p2283) ttttggatccAACTGGCAGAa{TAAAGATCTCAATTTAT}; (p2285) ttttggatcc{AACACAAACCATCACCCCTATTTT}</pre>
	## Click "Pick Primers"		## Click "Pick Primers"
	# Identify the base location that contains 785 C/T SNP		# Identify the base location that contains 785 C/T SNP

imported>Weigang: /* Web Exercise 3. Predict results of PCR and restriction analysis */

2013-09-27T00:32:22Z

Web Exercise 3. Predict results of PCR and restriction analysis

← Older revision		Revision as of 00:32, 27 September 2013
Line 72:		Line 72:
	## Point your browser to [http://primer3.ut.ee/ Primer3 Web Server]		## Point your browser to [http://primer3.ut.ee/ Primer3 Web Server]
	## Select "check_primer" in the top box, and "HUMAN" in the 2nd box		## Select "check_primer" in the top box, and "HUMAN" in the 2nd box
	## Paste the raw gene sequence into the 3rd box~~: Go to~~ the [http://www.ncbi.nlm.nih.gov/nuccore/NC_000007.13 GenBank page] ~~and click "FASTA" near the top of page~~		## Paste the raw gene sequence into the 3rd box from the [http://www.ncbi.nlm.nih.gov/nuccore/NC_000007.13?report=fasta&from=141672259&to=141673743&strand=true GenBank page]
	## Paste the two primer sequences into the 4th and 6th boxes: <pre>(p2283) ttttggatccAACTGGCAGAaTAAAGATCTCAATTTAT; (p2285) ttttggatccAACACAAACCATCACCCCTATTTT</pre>		## Paste the two primer sequences into the 4th and 6th boxes: <pre>(p2283) ttttggatccAACTGGCAGAaTAAAGATCTCAATTTAT; (p2285) ttttggatccAACACAAACCATCACCCCTATTTT</pre>
	## Click "Pick Primers"		## Click "Pick Primers"

imported>Weigang: /* Web Exercise 3. Predict results of PCR and restriction analysis */

2013-09-27T00:27:28Z

Web Exercise 3. Predict results of PCR and restriction analysis

← Older revision		Revision as of 00:27, 27 September 2013
Line 73:		Line 73:
	## Select "check_primer" in the top box, and "HUMAN" in the 2nd box		## Select "check_primer" in the top box, and "HUMAN" in the 2nd box
	## Paste the raw gene sequence into the 3rd box: Go to the [http://www.ncbi.nlm.nih.gov/nuccore/NC_000007.13 GenBank page] and click "FASTA" near the top of page		## Paste the raw gene sequence into the 3rd box: Go to the [http://www.ncbi.nlm.nih.gov/nuccore/NC_000007.13 GenBank page] and click "FASTA" near the top of page
	## Paste the two primer sequences into the 4th and 6th boxes		## Paste the two primer sequences into the 4th and 6th boxes: <pre>(p2283) ttttggatccAACTGGCAGAaTAAAGATCTCAATTTAT; (p2285) ttttggatccAACACAAACCATCACCCCTATTTT</pre>
	## Click "Pick Primers"		## Click "Pick Primers"
	# Identify the base location that contains 785 C/T SNP		# Identify the base location that contains 785 C/T SNP

imported>Weigang: /* Web Exercise 2. Cross-species comparisons with HomoloGene */

2013-09-25T18:51:16Z

Web Exercise 2. Cross-species comparisons with HomoloGene

← Older revision		Revision as of 18:51, 25 September 2013
Line 31:		Line 31:
	==Web Exercise 2. Cross-species comparisons with HomoloGene==		==Web Exercise 2. Cross-species comparisons with HomoloGene==
	# From the NCBI "TAS2R38" Gene page, click "HomoloGene" link under the "Related Information" (right-side navigation panel)		# From the NCBI "TAS2R38" Gene page, click "HomoloGene" link under the "Related Information" (right-side navigation panel)
	# You should see a page listing TAS2R38 orthologous (i.e., same gene in different species) genes from 7 mammalian species, including human (''Homo sapiens''), chimpanzee (''Pan troglodytes''), ~~macaca~~ (''Macaca mulatta''), dog (''Canis lupus familiaris''), cow (''Bos taurus''), rat (''Rattus norvegicus''), and mouse (''Mus musculus'').		# You should see a page listing TAS2R38 orthologous (i.e., same gene in different species) genes from 7 mammalian species, including human (''Homo sapiens''), chimpanzee (''Pan troglodytes''), macaque (''Macaca mulatta''), dog (''Canis lupus familiaris''), cow (''Bos taurus''), rat (''Rattus norvegicus''), and mouse (''Mus musculus'').
	# Write down your expectations for the following species relationships:		# Write down your expectations for the following species relationships:
	## Is chimpanzee more closely related to ~~macaca~~ or to human?		## Is chimpanzee more closely related to macaque or to human?
	## Is dog more related to mouse or to cow?		## Is dog more related to mouse or to cow?
	## Is rat and mouse more closely related than human and chimpanzee?		## Is rat and mouse more closely related than human and chimpanzee?
Line 44:		Line 44:
	\| Chimp-Human \|\| ? \|\| ?		\| Chimp-Human \|\| ? \|\| ?
	\|-		\|-
	\| Chimp-~~Macaca~~ \|\| ? \|\| ?		\| Chimp-Macaque \|\| ? \|\| ?
	\|-		\|-
	\| Dog-Cow \|\| ? \|\| ?		\| Dog-Cow \|\| ? \|\| ?

imported>Weigang: /* Statistical Exercise 1. Test Hardy-Weinberg Equilibrium */

2013-09-25T18:34:39Z

Statistical Exercise 1. Test Hardy-Weinberg Equilibrium

← Older revision		Revision as of 18:34, 25 September 2013
Line 99:		Line 99:
	{\| class="wikitable"		{\| class="wikitable"
	\|-		\|-
	\| f<sub>C</sub>=(2N<sub>CC</sub> + N<sub>CT</sub>)/N		\| f<sub>C</sub>=(2N<sub>CC</sub> + N<sub>CT</sub>)/2N
	\|-		\|-
	\| f<sub>T</sub>=(2N<sub>TT</sub> + N<sub>CT</sub>)/N		\| f<sub>T</sub>=(2N<sub>TT</sub> + N<sub>CT</sub>)/2N
	\|}		\|}
	</center>		</center>

imported>Weigang: /* Web Exercise 2. Cross-species comparisons with HomoloGene */

2013-09-23T13:58:45Z

Web Exercise 2. Cross-species comparisons with HomoloGene

← Older revision		Revision as of 13:58, 23 September 2013
Line 58:		Line 58:
	# Go to the [http://www.phylogeny.fr the phylogeny.fr web] and select "Phylogenetic Analysis" and then "One Click" analysis		# Go to the [http://www.phylogeny.fr the phylogeny.fr web] and select "Phylogenetic Analysis" and then "One Click" analysis
	# Copy and paste your downloaded sequences into the text box and click on "Submit"		# Copy and paste your downloaded sequences into the text box and click on "Submit"
	# When analysis is finished, ~~answer~~ the following questions:		# When analysis is finished, you should see a phylogenetic tree. Answer the following questions:
	## Define "orthologous genes"		## Define "orthologous genes"
	## What do tree nodes represent?		## What do tree nodes represent?
	## What do tree branches and branch length represent?		## What do tree branches and branch length represent?
	## How do you determine species relatedness based on a phylogenetic tree?		## How do you determine species relatedness based on a phylogenetic tree?
	##		## Do you think this gene tree reflects species relationships? How would you improve the inference of species tree (more genes, DNA instead of protein sequences)?
			## Do you think differences in protein sequences are associated with different sense of smells among these species? How would you test?

	==Web Exercise 3. Predict results of PCR and restriction analysis==		==Web Exercise 3. Predict results of PCR and restriction analysis==

imported>Weigang: /* Web Exercise 2. Cross-species comparisons with HomoloGene */

2013-09-23T13:35:24Z

Web Exercise 2. Cross-species comparisons with HomoloGene

← Older revision		Revision as of 13:35, 23 September 2013
Line 36:		Line 36:
	## Is dog more related to mouse or to cow?		## Is dog more related to mouse or to cow?
	## Is rat and mouse more closely related than human and chimpanzee?		## Is rat and mouse more closely related than human and chimpanzee?
	# Click on the link "Show Pairwise Alignment Scores" under "Protein Alignments" and fill in the following table when the page loads. Do these sequence-comparison results change your expectations above? Explain.		# Click on the link "Show Pairwise Alignment Scores" under "Protein Alignments" and fill in the following table when the page loads. Do these sequence-comparison results change your expectations in the above? Explain.
	<center>		<center>
	{\| class="wikitable"		{\| class="wikitable"
Line 57:		Line 57:
	# Click "Download" and, when the page uploads, click "download" again		# Click "Download" and, when the page uploads, click "download" again
	# Go to the [http://www.phylogeny.fr the phylogeny.fr web] and select "Phylogenetic Analysis" and then "One Click" analysis		# Go to the [http://www.phylogeny.fr the phylogeny.fr web] and select "Phylogenetic Analysis" and then "One Click" analysis
	# Copy and paste your downloaded sequences into the ~~textbox~~ and click on "Submit"		# Copy and paste your downloaded sequences into the text box and click on "Submit"
	# When analysis is finished, answer the following questions:		# When analysis is finished, answer the following questions:
	## Define "orthologous genes"		## Define "orthologous genes"
			## What do tree nodes represent?
			## What do tree branches and branch length represent?
	## How do you determine species relatedness based on a phylogenetic tree?		## How do you determine species relatedness based on a phylogenetic tree?
	## ~~What do tree branches and branch length represent?~~		##
	~~## What do tree nodes represent?~~

	==Web Exercise 3. Predict results of PCR and restriction analysis==		==Web Exercise 3. Predict results of PCR and restriction analysis==

imported>Weigang: /* Learning goals and outcomes */

2013-09-23T13:29:40Z

Learning goals and outcomes

← Older revision		Revision as of 13:29, 23 September 2013
Line 11:		Line 11:
	* Understand phenotype, genotype, and their association		* Understand phenotype, genotype, and their association
	* Be able to use the NCBI online databases		* Be able to use the NCBI online databases
			* Be able to compare genes among species using phylogeny
	* Be able to predict genotype frequencies based on Hardy-Weinberg equilibrium		* Be able to predict genotype frequencies based on Hardy-Weinberg equilibrium
	* Be able to use the contingency-table test of genotype-phenotype associations		* Be able to use the contingency-table test of genotype-phenotype associations