Dloayza: Dloayza moved page QuBi/module/bio203-lab12—2022 to QuBi/module/bio203-lab12—2023

2023-04-26T00:20:12Z

Dloayza moved page QuBi/module/bio203-lab12—2022 to QuBi/module/bio203-lab12—2023

← Older revision	Revision as of 00:20, 26 April 2023
(No difference)

Dloayza at 00:10, 26 April 2023

2023-04-26T00:10:56Z

← Older revision		Revision as of 00:10, 26 April 2023
Line 38:		Line 38:
	<ol start="6">		<ol start="6">
	<li>Scroll down to the bottom of the page and click "BLAST"		<li>Scroll down to the bottom of the page and click "BLAST"
	<li>Wait for 10-30 seconds for the results to return ('''be patient'''). Once the result page is loaded, locate and copy/write down		<li>Wait for 10-30 seconds for the results to return ('''be patient'''). Once the result page is loaded, locate and copy/write down the following information in your lab report file for the first hit:
	the following information in your lab report file for the first hit:
	<ol>		<ol>
	<li>Species and strain		<li>Species and strain

imported>Lab: correct lab number (12)-correct year (2022)

2022-04-26T19:15:51Z

correct lab number (12)-correct year (2022)

New page

<span style="color: Seagreen;font-weight:bold;font-size:large;">Lab 12. Bioinformatics Exercises: BLAST & Genomes
==Expected Learning Outcomes==
* Be able to perform NCBI BLAST search for homologous sequences in GenBank.
* Be able to identify homologs in other model organisms.
* Be able to identify alternative splice forms a single gene using NCBI web tools
* Be able to analyze locus structure from the information obtained from locus page
----

==Lab Report III==
# The lab report is worth 50 points.
# You have to complete the lab report by using the MS Word lab report template provided on Blackboard.
# Make sure to name your file with your LAST NAME-Lab12.
# you need to EMAIL your file to your T.A. to get credit for your work.

----

==Introduction==
Research in molecular genetics requires effective use of online bioinformatic tools to analyze and understand the genetic materials being worked with. The following exercises will expose you to real-world scenarios and introduce you to the methods and tools you can use to solve these problems.

In biology, homology is defined as a common or shared evolutionary origin. Therefore, homologous sequences are sequences diverged from a common ancestor. Note that the word "homology" is different from "similarity": homologous structures or sequences may not be similar (e.g., forearms in mammals and birds) and, conversely, similar structures or sequences may not be homologous (e.g., wings in birds and bats).

BLAST is a computer algorithm allowing for efficient search of similar sequences in a large database. While BLAST performs a similar function to Google search, you should not use Google to look for similar sequences in a human or other genome. When sequences are similar with a sufficient statistical significance (measured by e-value, see below), we consider these sequences homologous to each other.
----
==Exercise 1. Homology searching using BLAST==
# Go to the NCBI-BLAST website at [http://blast.ncbi.nlm.nih.gov/Blast.cgi NCBI/BLAST Home Page]
# To know more about BLAST, read the expanded answer by clicking on "Learn more"
# Since BLAST finds matches between nucleotide or protein sequences, it needs a "query" sequence as input as well as a "database" to search against. Make sure to know what your "query" sequence is and find the appropriate "database".
# Start BLASTing against the mouse genome by clicking "Mouse" under "BLAST Genomes"
# Copy and paste the following sequence into the "Enter Query Sequence" box:
<div style="font-family:Monospace;line-height:1;width:550px;border-style:solid;border-width:1px;border-color:#AAAAFF;background-color:#EEEEFF;padding-left:5px;padding-right:5px;padding-top:0px;padding-bottom:0px;">
CTAGATGCATTTACGAAGGAGACAGAAAACGTCTTTCGGCAATAGCTCTCAAATGCAAAACGACGTCGG
CGAGCTGTCCCTTACCTGGAGGCCCGCAGGAGAAGCGCGGTGATCCGAGAGGGTCCCCCAGGGGTGTCCG
GTCGGTCTCCCGCTCGCCCAGCAGACGGCTGCGGAAACGGGGCAGCGTTTAAATAACCCCAGCTGGAGAC
ATGTCAGGACTTAGCTCCTCCGACAGCCGACGCCGGACGTGTCCCAACTTGACCAGCCCCACAGGAAGAG
CTGAGTCAACTCGGCCCAGCCCAGTCCCACCCGTCCCGGAAGCCGCATCCCGGCGAGTCCGGGACCAGGC
ACCTGTCACCTCCTGGACCCCAGCAACGAGCCCAGCGCGACCCCGGAGCGGGCCCGAATTCT
</div>
<ol start="6">
<li>Scroll down to the bottom of the page and click "BLAST"
<li>Wait for 10-30 seconds for the results to return ('''be patient'''). Once the result page is loaded, locate and copy/write down
the following information in your lab report file for the first hit:
<ol>
<li>Species and strain
<li>Chromosome
<li>Length of your query sequence
<li>Percent identity, number of matched bases, and number of gaps between the matched sequences
</ol>
<li>Click "Genome Data Viewer" at top right will bring you to a genome browser
<li>Mouse-over the green central segment labeled "biological regions, aggregate" (just under the query, in red) and click the link "GenBank View". A standard GenBank file of this gene will load. Locate the 1st "mRNA" feature block and write down the following structural information about this gene in your lab report file:
<ol>
<li>Locus ID
<li>Total length of the gene

<li>Number of exons
<li>How many mRNAs do you find for this sequence? How many exons are there for the smallest mRNA? Why are there several mRNAs shown for one gene?
</ol>
</ol>
----

==Exercise 2. Explore the structure of human ''mdm2'' gene==
# Search [http://www.ncbi.nlm.nih.gov/sites/entrez?db=Nucleotide GenBank] using the accession AF527840.
#Click on "Gene", located on the right side of the page, under "Related Information"
#Write down the gene name, and a brief description of its function
#Scroll down the page: you will se a window showing the various transcripts encoded by this gene. The vertical bars are the exonic sequences, and the coding portions are indicated in dark green.
#find transcript variant 1-isoform a: this is the longest isoform. How many exons and introns does this transcript have? How many nucleotides does the coding sequence contain? How many amino acids does it code for?
#Go back to the GenBank file and click on the "mRNA" feature, on the left of the window. The exons will be highlighted on the sequence. Scroll back up to the beginning of the gene.
#Write down the coordinates (1st and last nucleotide) for exon 1 and for exon 2 (hint: you do not need to count the bases).
#Now click on the "CDS" feature (coding sequence). Where does the highlighted sequence start, and in which exon? What does this point correspond to?
# Obtain the intron/exon gene structure and copy into your lab report file. To do this:
##on top of the Genbank page for AF527840 click on the "Graphics" link
##you will see a window with a diagram, showing the genomic sequence in green, the primary transcript in purple, and the coding sequence in red
##copy and paste this diagram into your lab report (or create a desktop picture, crop as needed and paste into your lab report file)
# Answer the following questions, in your lab report file:
## Do all exon sequences code for proteins? Are there non-coding exons in mdm2, and if so which ones?
## Copy/past and align the first 5 bases of all introns. Which bases are conserved near intron start ("donor site")?
## Do the same with the last 5 bases of all introns. Which bases are conserved near intron end ("acceptor site")?
## Using [http://weblogo.berkeley.edu/ WebLogo] and make a sequence logo for the acceptor site and another sequence logo for the donor site. To do so, copy & paste individual sequences at the acceptor site into [http://weblogo.threeplusone.com/create.cgi this text box] and click "Create Logo". Save the resulting image file and paste it into your lab report file. Repeat for the donor-site sequences.
<center>

</center>
----

==Exercise 3. MDM2 homologs in other species==
This exercise will consist in comparing the predicted protein sequences of MDM2 in three species: human (H. sapiens), mouse (M. musculus) and zebrafish (D. rerio).
You will need to download the human MDM2 sequence, find the mouse and fish homologs, and copy each sequence into a MS Word file using the following format:

[Blank line]
>Human MDM2
--your amino acid sequence here--
>Mouse MDM2
--your amino acid sequence here--
>Zebrafish MDM2
--your amino acid sequence here--

First, you will download the human MDM2 protein sequence. You will then use this sequence as a query to identify the mouse and zebrafish sequences. Follow these steps:

# Go to this link: https://www.ncbi.nlm.nih.gov/genome/guide/human/
# in the box "search for human genes" type in "MDM2"
# you will see many hits- the top one corresponds to the human MDM2 locus- click on the link
# This is the human MDM2 locus page- there is much information here. Scroll down to "Genomic regions, transcripts, and products"
# You see here a map of the known transcripts produced for this locus
# now scroll down to "mRNA and Protein(s)"
# here, find the entry corresponding to the LONGEST isoform
# for each entry, you will see two identifiers : NM_.... and NP_....
# NM_... corresponds to the mRNA sequence for this isoform, and NP_.... to its predicted protein sequence
# click on the link for the protein sequence for the longest isoform, and find the 'FASTA' format
# copy the protein sequence by highlighting all residues from the initial 'M' to the last residue- nothing else
# paste the sequence into your word file as instructed above

now let's find the mouse homolog using the human sequence as a query:

#go to the main NCBI link: https://www.ncbi.nlm.nih.gov
#on the right side, under "Popular resources", click on "Blast"
#click on 'mouse' to blast the mouse genome- make sure you use the right tool (blastp) and the correct database (Refseq Protein)
#in the window, paste in your human MDM2 sequence- this is your query, and click on "BLAST"
#wait a few minutes... you will see your screen refreshing a few times
#you get a number of hits- scroll down to the best one (under "alignments") and click on "gene" on the right side, under "related information"
#you are now on the mouse MDM2 locus page: find the protein sequence to the LONGEST isoform and paste into your page as above

now let us get the Zebrafish homolog:

#go to the genome portal : http://zfin.org
#find the protein sequence and paste into your page as above. Make sure you use the right program and database for a protein BLAST!

you will now make an alignment of all three sequences to see potential identities or similarities between them

#this involves two steps: first, the production of an output file by a program called "Clustal W"
# and second, the processing of this file to generate an alignment figure by a program called "Boxshade"
#go to this link: http://www.genome.jp/tools-bin/clustalw
#in the top window, paste in your three sequence by selecting from your first ">" sign to the end of your file (do not take your header, with your names)
# click on "execute multiple alignment"
#you will see an 'aln' output file at the bottom: select the file including the header on top "CLUSTAL 2.1 multiple sequence alignment" down to the bottom of the file (no extra spaces, but include the '+ = .. symbols')- copy in the buffer- you will paste this in the Boxshade program
#to do the alignment figure, go to : https://embnet.vital-it.ch/software/BOX_form.html
#there, scroll down and find the empty window in which to enter/paste a sequence- toggle to 'ALN' format and in the window below that, paste your aln file (the one you copied from CLUSTAL W just now)
#click on 'run boxshade'
#under results: click on 'boxshade output 1"--- here's your alignment! (this should open with adobe acrobat and might take a bit of time)
#the output is a pdf file-- save it and import into your lab report word file (as page 2) by doing an "Insert--- picture from file" in MS Word- you will have two pages: page 1 with your MDM2 sequences, and page 2 with your alignment

==Additional questions: answer 3 questions from the ones shown below and include in your lab report--==
# Explain the BLAST term: “Expect” (e-value) [http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=FAQ#expect Read this FAQ]
# Which is a statistically more significant match by BLAST, a match with an e-value=1e-5 or a match with an e-value of 1?
# List and describe individual elements of a typical human gene based on mdm2.
#what are two determinants that can lead to the production of isoforms for a specific locus?
# What is the "GT-AG" rule? Explain how to read the sequence logos. Explain the significance of sequence conservation at exon-intron junctions.
#look at your alignment from part III: what are the black boxes- the grey boxes?
#do you see many gaps/insertions?do you think there is a pattern?

----

QuBi/module/bio203-lab12—2023 - Revision history

Dloayza: Dloayza moved page QuBi/module/bio203-lab12—2022 to QuBi/module/bio203-lab12—2023

Dloayza at 00:10, 26 April 2023

imported>Lab: correct lab number (12)-correct year (2022)