QuBi/modules/biol203-geno-pheno-association - Revision history

imported>Lab at 02:16, 24 July 2020

2020-07-24T02:16:06Z

← Older revision		Revision as of 02:16, 24 July 2020
Line 1:		Line 1:
	; <div style="font-size:180%">BIOL 203 Bioinformatics Exercises for Lab 11</div>		; <div style="font-size:180%">BIOL 203 Summer 2020 - Bioinformatics Exercises for Lab 11</div>
	----		----
	==Test phenotype-genotype association==		==Test phenotype-genotype association==

imported>Lab at 02:15, 24 July 2020

2020-07-24T02:15:35Z

← Older revision		Revision as of 02:15, 24 July 2020
Line 1:		Line 1:
	; <div style="font-size:180%">BIOL 203 Bioinformatics Exercises for Lab 13</div>		; <div style="font-size:180%">BIOL 203 Bioinformatics Exercises for Lab 11</div>
	----		----
	==Test phenotype-genotype association==		==Test phenotype-genotype association==

imported>Lab at 00:21, 6 May 2020

2020-05-06T00:21:13Z

← Older revision		Revision as of 00:21, 6 May 2020
Line 3:		Line 3:
	==Test phenotype-genotype association==		==Test phenotype-genotype association==
	===Introduction: GWAS & Contingency Test===		===Introduction: GWAS & Contingency Test===
	Genome-Wide Association Study (GWAS) is a method for mapping phenotypes to genotypes. In a typical GWAS study, frequencies of alleles (e.g., C or T at position 785) are determined in a sample of affected individuals (the "cases") as well as in a sample of unaffected individuals (the "controls"). For example, the following table shows results of a hypothetical case-control study at a locus segregating with two alleles (C and T):		Genome-Wide Association Study (GWAS) is a method for mapping phenotypes to genotypes. In a typical GWAS study, frequencies of alleles (e.g., C or T at position 785) are determined in a sample of affected individuals (the "cases" e.g. disease) as well as in a sample of unaffected individuals (the "controls"). For example, the following table shows results of a hypothetical case-control study at a locus segregating with two alleles (C and T):

	<center>		<center>
Line 24:		Line 24:

	2. Deriving from Table 1, fill the following table with allele counts. Then perform a 2-by-2 contingency table analysis using the link above.		2. Deriving from Table 1, fill the following table with allele counts. Then perform a 2-by-2 contingency table analysis using the link above.
	For example, in the controls, the number of T alleles is: 18 + 68 = 86 , because ~~homoygotes~~ have two alleles and heterozygotes have one.		For example, in the controls, the number of T alleles is: 18 + 68 = 86 , because homozygotes have two alleles and heterozygotes have one.

	Is there a statistically significant association between alleles and disease phenotype? Which allele (C or T) is over-represented in (i.e., statistically associated with) disease cases?		Is there a statistically significant association between alleles and disease phenotype? Which allele (C or T) is over-represented in (i.e., statistically associated with) disease cases?

imported>Lab at 00:20, 6 May 2020

2020-05-06T00:20:09Z

← Older revision		Revision as of 00:20, 6 May 2020
Line 21:		Line 21:
	Association between the genotype and the phenotype could be assessed with a [http://en.wikipedia.org/wiki/Contingency_table contingency table analysis]. In this case, Χ<sup>2</sup> = 26.4, p<0.0005, suggesting a significant association between genotypes and diseases. (By comparing the expected and observed counts, one could conclude that the C/C genotypes are over-represented in disease cases.)		Association between the genotype and the phenotype could be assessed with a [http://en.wikipedia.org/wiki/Contingency_table contingency table analysis]. In this case, Χ<sup>2</sup> = 26.4, p<0.0005, suggesting a significant association between genotypes and diseases. (By comparing the expected and observed counts, one could conclude that the C/C genotypes are over-represented in disease cases.)

	# Perform an [http://www.physics.csbsju.edu/stats/contingency.html online contingency table analysis] using the hypothetical data in Table 1. Click on "other contingency tables" and do a 2-rows and 3-columns test with the data above. Your Χ<sup>2</sup> should be 26.4.		1. Perform an [http://www.physics.csbsju.edu/stats/contingency.html online contingency table analysis] using the hypothetical data in Table 1. Click on "other contingency tables" and do a 2-rows and 3-columns test with the data above. Your Χ<sup>2</sup> should be 26.4.

	# Deriving from Table 1, fill the following table with allele counts. Then perform a 2-by-2 contingency table analysis using the link above.		2. Deriving from Table 1, fill the following table with allele counts. Then perform a 2-by-2 contingency table analysis using the link above.
	For example, in the controls, the number of T alleles is: 18 + 68 = 86 , because homoygotes have two alleles and heterozygotes have one.		For example, in the controls, the number of T alleles is: 18 + 68 = 86 , because homoygotes have two alleles and heterozygotes have one.

imported>Lab at 00:18, 6 May 2020

2020-05-06T00:18:46Z

← Older revision		Revision as of 00:18, 6 May 2020
Line 19:		Line 19:
	</center>		</center>

	Association between the genotype and the phenotype could be assessed with a [http://en.wikipedia.org/wiki/Contingency_table contingency table analysis]. In this case, Χ<sup>2</sup> = 26.4, p=0.0005, suggesting a significant association between genotypes and diseases. (By comparing the expected and observed counts, one could conclude that the C/C genotypes are over-represented in disease cases.)		Association between the genotype and the phenotype could be assessed with a [http://en.wikipedia.org/wiki/Contingency_table contingency table analysis]. In this case, Χ<sup>2</sup> = 26.4, p<0.0005, suggesting a significant association between genotypes and diseases. (By comparing the expected and observed counts, one could conclude that the C/C genotypes are over-represented in disease cases.)

	# Perform an [http://www.physics.csbsju.edu/stats/contingency.html online contingency table analysis] using the hypothetical data in Table 1.		# Perform an [http://www.physics.csbsju.edu/stats/contingency.html online contingency table analysis] using the hypothetical data in Table 1. Click on "other contingency tables" and do a 2-rows and 3-columns test with the data above. Your Χ<sup>2</sup> should be 26.4.

	# Deriving from Table 1, fill the following table with allele counts. Then perform a 2-by-2 contingency table analysis using the link above. Is there a statistically significant association between alleles and disease phenotype? Which allele (C or T) is over-represented in (i.e., statistically associated with) disease cases?		# Deriving from Table 1, fill the following table with allele counts. Then perform a 2-by-2 contingency table analysis using the link above.
			For example, in the controls, the number of T alleles is: 18 + 68 = 86 , because homoygotes have two alleles and heterozygotes have one.

			Is there a statistically significant association between alleles and disease phenotype? Which allele (C or T) is over-represented in (i.e., statistically associated with) disease cases?
	<center>		<center>
	Table 2. Sample Allele Frequencies		Table 2. Sample Allele Frequencies

imported>Lab at 15:48, 9 May 2018

2018-05-09T15:48:31Z

← Older revision		Revision as of 15:48, 9 May 2018
Line 38:		Line 38:
	</center>		</center>

	===Test association ~~at Locus~~ A===		===Test association with locus A===
	Following the above two examples, perform both the genotype and allele association tests using the class data.		Following the above two examples, perform both the genotype and allele association tests using the class data.
	<center>		<center>
Line 69:		Line 69:
	</center>		</center>

	===Test association at Locus B===		===Test association with Locus B===
	Table 4a. Genotype counts at Locus B for each phenotype		Table 4a. Genotype counts at Locus B for each phenotype
	<center>		<center>
Line 100:		Line 100:
	==Web Exercise. Search for gene information using NCBI online databases==		==Web Exercise. Search for gene information using NCBI online databases==
	# Point your browser to the [http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome NCBI Human Genome Resource] page		# Point your browser to the [http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome NCBI Human Genome Resource] page
	# Copy and paste sequence ~~at Locus A into~~ the ~~first text box (add a FASTA heading, e.g., ">Locus_A")~~		# Copy and paste sequence provided on Blackboard- this is the sequence of the gene associated with the taster phenotype
	# Expand the "Algorithm parameters" tab and change "Expect threshold" to 0.00001 (10e-5). Define "expect value" in your owns words after watching the linked Youtube video.		# Expand the "Algorithm parameters" tab and change "Expect threshold" to 0.00001 (10e-5). Define "expect value" in your owns words after watching the linked Youtube video.
	# Press "BLAST". Copy & Paste the top hit in your final lab report.		# Press "BLAST". Copy & Paste the top hit in your final lab report.
	# ~~Repeat~~ the ~~above for~~ the ~~sequence at Locus B. Copy and paste~~ the ~~top hit in your final lab report.~~		# Briefly describe the function of the gene based on information gathered on the locus page

	==Lab Report IV==		==Lab Report IV==
Line 109:		Line 109:
	## A printout of contingency test for Locus A, including expected counts, observed counts, chi-square statistic, degree of freedom, and p values		## A printout of contingency test for Locus A, including expected counts, observed counts, chi-square statistic, degree of freedom, and p values
	## Same as above for Locus B		## Same as above for Locus B
	## A printout of alignment for the top BLAST hits for ~~Locus A~~ sequence		## A printout of alignment for the top BLAST hits for the sequence provided
	~~## Same as above for Locus B~~
	Additional questions to include in your report:		Additional questions to include in your report:
	## State what is the ''null hypothesis'' in a chi-square test & what is the ''alternative hypothesis''		## State what is the ''null hypothesis'' in a chi-square test & what is the ''alternative hypothesis''
Line 116:		Line 115:
	## What can you conclude when p-value is '''below''' the threshold of significance (e.g., p = 0.05)?		## What can you conclude when p-value is '''below''' the threshold of significance (e.g., p = 0.05)?
	## What would you conclude when p-value is '''above''' the critical value?		## What would you conclude when p-value is '''above''' the critical value?
	~~## Which of the two genes shows significant ''genotype'' association with the PTC Taster/Non-Taster phenotype?~~		## Is there a statistically significant association between one of the alleles tested and the Taster phenotype?
	## Is there a statistically significant association between the ''alleles'' and the Taster phenotype?
	## Which genotype is over-represented in the Non-Tasters?		## Which genotype is over-represented in the Non-Tasters?
	## Which allele is over-represented in the Non-Tasters?		## Which allele is over-represented in the Non-Tasters?
	## Are there exceptions? What are possible causes for exceptions?		## Are there exceptions? What are possible causes for exceptions?
	## Define e-value in a BLAST search		## Define e-value in a BLAST search

imported>Lab: /* Lab Report IV */

2017-05-09T17:30:08Z

Lab Report IV

← Older revision		Revision as of 17:30, 9 May 2017
Line 105:		Line 105:
	# Repeat the above for the sequence at Locus B. Copy and paste the top hit in your final lab report.		# Repeat the above for the sequence at Locus B. Copy and paste the top hit in your final lab report.

	==Lab Report ~~& Exit Questions~~==		==Lab Report IV==
	# Your report should include the following results:		# Your report should include the following results:
	## A printout of contingency test for Locus A, including expected counts, observed counts, chi-square statistic, degree of freedom, and p values		## A printout of contingency test for Locus A, including expected counts, observed counts, chi-square statistic, degree of freedom, and p values
Line 111:		Line 111:
	## A printout of alignment for the top BLAST hits for Locus A sequence		## A printout of alignment for the top BLAST hits for Locus A sequence
	## Same as above for Locus B		## Same as above for Locus B
	~~# Exit~~ questions		Additional questions to include in your report:
	## State what is the ''null hypothesis'' in a chi-square test & what is the ''alternative hypothesis''		## State what is the ''null hypothesis'' in a chi-square test & what is the ''alternative hypothesis''
	## Explain what probability is represented by the p-value.		## Explain what probability is represented by the p-value.

imported>Weigang at 02:40, 4 April 2016

2016-04-04T02:40:21Z

@@ Line 97: / Line 97: @@
 |}
 </center>
 ==Web Exercise. Search for gene information using NCBI online databases==
@@ Line 115: / Line 104: @@
 # Press "BLAST". Copy & Paste the top hit in your final lab report.
 # Repeat the above for the sequence at Locus B. Copy and paste the top hit in your final lab report.

imported>Weigang: /* Web Exercise 1. Search for gene information using NCBI online databases */

2016-04-04T02:05:01Z

Web Exercise 1. Search for gene information using NCBI online databases

← Older revision		Revision as of 02:05, 4 April 2016
Line 109:		Line 109:
	# Are there exceptions? What are possible causes for exceptions?		# Are there exceptions? What are possible causes for exceptions?

	==Web Exercise 1. Search for gene information using NCBI online databases==		==Web Exercise. Search for gene information using NCBI online databases==
	# Point your browser to the [http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome NCBI Human Genome Resource] page		# Point your browser to the [http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome NCBI Human Genome Resource] page
	# Copy and paste sequence at Locus A into the first text box (add a FASTA heading, e.g., ">Locus_A")		# Copy and paste sequence at Locus A into the first text box (add a FASTA heading, e.g., ">Locus_A")

imported>Weigang: /* Web Exercise 3. Predict results of PCR and restriction analysis */

2016-04-04T02:04:43Z

Web Exercise 3. Predict results of PCR and restriction analysis

← Older revision		Revision as of 02:04, 4 April 2016
Line 115:		Line 115:
	# Press "BLAST". Copy & Paste the top hit in your final lab report.		# Press "BLAST". Copy & Paste the top hit in your final lab report.
	# Repeat the above for the sequence at Locus B. Copy and paste the top hit in your final lab report.		# Repeat the above for the sequence at Locus B. Copy and paste the top hit in your final lab report.

	~~==Web Exercise 3. Predict results of PCR and restriction analysis==~~
	~~On a printout of the DNA sequence of TAS2R38 gene (from the GenBank link, see above),~~
	~~# Identify 5'-UTR, 3'-UTR, start codon, and stop codon.~~
	~~# Identify the regions your PCR primers should bind using the Primer3 web server~~
	~~## Point your browser to [http://primer3.ut.ee/ Primer3 Web Server]~~
	~~## Select "check_primer" in the top box, and "HUMAN" in the 2nd box~~
	~~## Paste the raw gene sequence into the 3rd box from the [http://www.ncbi.nlm.nih.gov/nuccore/NC_000007.13?report=fasta&from=141672259&to=141673743&strand=true GenBank page]~~
	## Paste the two primer sequences (use only the sequences within {}) into the 4th and 6th boxes: <pre>(p2283) ttttggatccAACTGGCAGAa{TAAAGATCTCAATTTAT}; (p2285) ttttggatcc{AACACAAACCATCACCCCTATTTT}</pre>
	~~## Click "Pick Primers"~~
	~~# Identify the base location that contains 785 C/T SNP~~
	~~# Copy and paste the expected 303-bp section and locate the Fnu4H1 site using the [http://tools.neb.com/NEBcutter2/ NEBcutter website]~~
	~~# What are the expected lengths for the C/C, C/T, and T/T genotypes?~~