FleQ unique align: Revision history

Jump to navigation Jump to search

Diff selection: Mark the radio buttons of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

16 July 2013

  • curprev 17:1417:14, 16 July 2013‎ imported>Rayrah‎ 23,188 bytes +23,188‎ Created page with "<pre> CLUSTAL W (1.81) multiple sequence alignment Psyringae_pv. atgtggcgtgaaatcaagattctgctaatcgatgacgatagccagcgccgccgggatctg Pfluorescens_A506_fleQ atgtggcgtgaaa..."
Retrieved from "https://wiki.genometracker.org/w/FleQ_unique_align"