QuBi/modules/biol203-Lab4: Difference between revisions

From QiuLab
Jump to navigation Jump to search
imported>Weigang
imported>Weigang
Line 23: Line 23:
BLAST is a computer algorithm allowing for efficient search of similar sequences in a large database. While BLAST performs a similar function to Google search, you should not use Google to look for similar sequences in a human or other genome. When sequences are similar with a sufficient statistical significance (measured by e-value, see below), we consider these sequences homologous to each other.
BLAST is a computer algorithm allowing for efficient search of similar sequences in a large database. While BLAST performs a similar function to Google search, you should not use Google to look for similar sequences in a human or other genome. When sequences are similar with a sufficient statistical significance (measured by e-value, see below), we consider these sequences homologous to each other.
----
----
==Exercise 1. Homology searching using BLAST==
# Go to the NCBI-BLAST website at [http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&%20PAGE_TYPE=BlastHome NCBI/BLAST Home Page]
# What is BLAST? Read and copy the expanded answer by clicking on "more"
# Since BLAST finds matches between biological sciences, it needs a "query" sequence as input as well as a "database" to search against. To find matches of a sequence in human genome, what would be your "query" sequence and what would be your "database"?
# Start BLASTing against the mouse genome by clicking "Mouse" under "BLAST Assembled RefSeq Genomes"
# Copy and paste the following sequence into the "Enter Query Sequence" box:
<div style="font-family:Monospace;line-height:1;width:550px;border-style:solid;border-width:1px;border-color:#AAAAFF;background-color:#EEEEFF;padding-left:5px;padding-right:5px;padding-top:0px;padding-bottom:0px;">
CTAGATGCATTTACGAAGGAGACAGAAAACGTCTTTCGGCAATAGCTCTCAAATGCAAAACGACGTCGG
CGAGCTGTCCCTTACCTGGAGGCCCGCAGGAGAAGCGCGGTGATCCGAGAGGGTCCCCCAGGGGTGTCCG
GTCGGTCTCCCGCTCGCCCAGCAGACGGCTGCGGAAACGGGGCAGCGTTTAAATAACCCCAGCTGGAGAC
ATGTCAGGACTTAGCTCCTCCGACAGCCGACGCCGGACGTGTCCCAACTTGACCAGCCCCACAGGAAGAG
CTGAGTCAACTCGGCCCAGCCCAGTCCCACCCGTCCCGGAAGCCGCATCCCGGCGAGTCCGGGACCAGGC
ACCTGTCACCTCCTGGACCCCAGCAACGAGCCCAGCGCGACCCCGGAGCGGGCCCGAATTCT
</div>
<ol start="6">
<li>Scroll down to the bottom of the page and click "BLAST"
<li>Wait for 10-30 seconds for the results to return ('''be patient'''). Once the result page is loaded, locate and copy/write down
the following information for the first hit:
<ol>
<li>Species and strain
<li>Chromosome
<li>Length of your query sequence
<li>Sequence identity, number of matched bases, and number of gaps between the matched sequences
</ol>
<li>Click the link for "5' side" (next to '''Features''') will bring you a standard GenBank file of this gene. Locate and copy the
following structural information about this gene:
<ol>
<li>Gene accession (ID number)
<li>Total length of the gene
<li>Number of introns
<li>Which is the non-template (mRNA analog) strand: the above sequence itself or its reverse complement? [Hint: note the word '''complement''' in mRNA and cDNA lines)
<ol>
</ol>

Revision as of 02:18, 11 February 2015

Lab 4. Bioinformatics Exercises: BLAST & Gene Structure

Expected Learning Outcomes

  • Be able to perform NCBI BLAST search for homologous sequences in GenBank.
  • Be able to identify individual gene elements based on an NCBI GenBank file.
  • Be able to identify alternative splice forms a single gene using NCBI web tools

Lab Report Grading Policy

  1. Introduction (5 pts). Define these terms: bioinformatics, homology, BLAST, e-value, alternative splicing (Your statements are not to be copied from the Lab Manual.)
  2. Materials and Methods (5 pts). List and describe steps of a BLAST search & steps of identifying alternative splicing variants with BLAST.
  3. Results (20 pts). Copy your results in a document during the exercises, and hand in an organized copy. Include answers to all queries and questions.
  4. Discussion and Conclusion (15 pts). Answer the five discussion questions. Summary/Conclusion: a sentence or two will suffice.
  5. References (5 pt). Credit is given for pertinent references obtained from sources other than the Lab Manual.

(Total: 50 pts)


Introduction

Research in molecular genetics requires effective use of online bioinformatic tools to analyze and understand the genetic materials being worked with. The following exercises will expose you to real-world scenarios and introduce you to the methods and tools you can use to solve these problems.

In biology, homology is defined as a common or shared evolutionary origin. Therefore, homologous sequences are sequences diverged from a common ancestor. Note that the word "homology" is different from "similarity": homologous structures or sequences may not be similar (e.g., forearms in mammals and birds) and, conversely, similar structures or sequences may not be homologous (e.g., wings in birds and bats).

BLAST is a computer algorithm allowing for efficient search of similar sequences in a large database. While BLAST performs a similar function to Google search, you should not use Google to look for similar sequences in a human or other genome. When sequences are similar with a sufficient statistical significance (measured by e-value, see below), we consider these sequences homologous to each other.


Exercise 1. Homology searching using BLAST

  1. Go to the NCBI-BLAST website at NCBI/BLAST Home Page
  2. What is BLAST? Read and copy the expanded answer by clicking on "more"
  3. Since BLAST finds matches between biological sciences, it needs a "query" sequence as input as well as a "database" to search against. To find matches of a sequence in human genome, what would be your "query" sequence and what would be your "database"?
  4. Start BLASTing against the mouse genome by clicking "Mouse" under "BLAST Assembled RefSeq Genomes"
  5. Copy and paste the following sequence into the "Enter Query Sequence" box:

CTAGATGCATTTACGAAGGAGACAGAAAACGTCTTTCGGCAATAGCTCTCAAATGCAAAACGACGTCGG CGAGCTGTCCCTTACCTGGAGGCCCGCAGGAGAAGCGCGGTGATCCGAGAGGGTCCCCCAGGGGTGTCCG GTCGGTCTCCCGCTCGCCCAGCAGACGGCTGCGGAAACGGGGCAGCGTTTAAATAACCCCAGCTGGAGAC ATGTCAGGACTTAGCTCCTCCGACAGCCGACGCCGGACGTGTCCCAACTTGACCAGCCCCACAGGAAGAG CTGAGTCAACTCGGCCCAGCCCAGTCCCACCCGTCCCGGAAGCCGCATCCCGGCGAGTCCGGGACCAGGC ACCTGTCACCTCCTGGACCCCAGCAACGAGCCCAGCGCGACCCCGGAGCGGGCCCGAATTCT

  1. Scroll down to the bottom of the page and click "BLAST"
  2. Wait for 10-30 seconds for the results to return (be patient). Once the result page is loaded, locate and copy/write down the following information for the first hit:
    1. Species and strain
    2. Chromosome
    3. Length of your query sequence
    4. Sequence identity, number of matched bases, and number of gaps between the matched sequences
  3. Click the link for "5' side" (next to Features) will bring you a standard GenBank file of this gene. Locate and copy the following structural information about this gene:
    1. Gene accession (ID number)
    2. Total length of the gene
    3. Number of introns
    4. Which is the non-template (mRNA analog) strand: the above sequence itself or its reverse complement? [Hint: note the word complement in mRNA and cDNA lines)