Biol425 2017: Difference between revisions

From QiuLab
Jump to navigation Jump to search
imported>Lab
No edit summary
imported>Ntino
mNo edit summary
 
(167 intermediate revisions by 2 users not shown)
Line 1: Line 1:
<center>'''Computational Molecular Biology''' (BIOL 425/790.49, Spring 2015)</center>
<center>'''Computational Molecular Biology''' (BIOL 425/790.49, Spring 2017)</center>
<center>'''Instructor:''' Dr Konstantinos Krampis, Associate Professor of Biology</center>
<center>'''Instructor:''' Dr Konstantinos Krampis, Associate Professor of Biology</center>
<center>'''Room:'''1000G HN (10th Floor, North Building, Computer Science Department,  [http://www.geography.hunter.cuny.edu/tbw/CS.Linux.Lab.FAQ/department_of_computer_science.faq.htm Linux Lab FAQ])</center>
<center>'''Room:'''1000G HN (10th Floor, North Building, Computer Science Department,  [http://www.geography.hunter.cuny.edu/tbw/CS.Linux.Lab.FAQ/department_of_computer_science.faq.htm Linux Lab FAQ])</center>
<center>'''Class Hours:''' Wednesdays 10:10 am-12:40 pm </center>
<center>'''Class Hours:''' Wednesdays 10:10 am-12:40 pm </center>
<center>'''Office Hours & Address:''' Hours: 11am-3pm on Wednesdays Address: Belfer Research Building, 413 East 69th Street (between York and 1st Avenue), New York, NY 10021. [https://www.google.com/maps/place/413+E+69th+St,+New+York,+NY+10021/@40.7655886,-73.9561743,17z/data=!3m1!4b1!4m2!3m1!1s0x89c258c3d235f76f:0x4f3d0d5d8a78fe6?hl=en Direction via Google Map]; </center>
<center>'''Office Hours & Address:''' Hours: 10am-12pm on Tuesdays Address: Belfer Research Building, 413 East 69th Street (between York and 1st Avenue), New York, NY 10021. Wednesdays 10:10 am-12:40 pm 
[https://www.google.com/maps/place/413+E+69th+St,+New+York,+NY+10021/@40.7655886,-73.9561743,17z/data=!3m1!4b1!4m2!3m1!1s0x89c258c3d235f76f:0x4f3d0d5d8a78fe6?hl=en Direction via Google Map]; </center>
<center>'''IMPORTANT: [http://www.geography.hunter.cuny.edu/tbw/CS.Linux.Lab.FAQ/department_of_computer_science.faq.htm LINUX INSTRUCTIONS AND ACCESSING COMPUTERS REMOTELY]''' </center>
----
----
==Course Schedule (All Wednesdays)==
==Course Schedule (All Wednesdays)==


===February 3. Course overview & Unix tools===
===February 1. Course overview & Unix tools===
* Course Overview. Lecture slides: [[File:Sildes-02-03-2016.pdf|thumbnail]]
* Course Overview. Lecture slides: [[File:Sildes-02-03-2016.pdf|thumbnail]]
* Learning Goals: (1) Understand the "Omics" files; (2) Review/Learn Unix tools
* Learning Goals: (1) Understand the "Omics" files; (2) Review/Learn Unix tools
Line 45: Line 47:
{| class="wikitable sortable mw-collapsible"
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
|- style="background-color:lightsteelblue;"
! Assignment #1 - (<font color="red">Due Wednesday 2/10/2016, at 10am - Submit Responses on Blackboard</font>)
! Assignment #1 - (<font color="red">Due Wednesday 2/08/2017, at 10am - Submit Responses on Blackboard as document with all command line outputs</font>)
|- style="background-color:powderblue;"
|- style="background-color:powderblue;"
| '''Unix Text Filters''' (10 pts) Show both commands and outputs for the following questions:<br>  
| '''Unix Text Filters''' (10 pts) Show both commands and outputs for the following questions:<br>  
Line 59: Line 61:
----
----


=== February 10. Genomics (1): Gene-Finding===
=== February 8. Genomics (1): Gene-Finding===
* Learning goals: (1) Running UNIX programs; (2) Parse text with Perl anonymous hash
* Learning goals: (1) Running UNIX programs; (2) Parse text with Perl anonymous hash
* Lecture slides: [[File: Slides-2-10-2016.pdf|thumbnail]]
* Lecture slides: [[File: Slides-2-10-2016.pdf|thumbnail]]
Line 88: Line 90:
{| class="wikitable sortable mw-collapsible"
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
|- style="background-color:lightsteelblue;"
! Assignment #2 (<font color="red">Due Wednesday 2/17/2016, at 10am - Submit Responses on Blackboard</font>)
! Assignment #2 (<font color="red">Due Wednesday 2/15/2017, at 10am - Submit Responses on Blackboard</font>)
|- style="background-color:powderblue;"
|- style="background-color:powderblue;"
| '''UNIX Exercises and Reading Material''' (10 pts)<br>
| '''UNIX Exercises and Reading Material''' (10 pts)<br>
Line 112: Line 114:
----
----


===February 17. Genomics (2): BASH & BLAST===
===February 15. CANCELLED CLASSES ON A MONDAY SCHEDULE ===
===February 22. Genomics (2): BASH & BLAST===
* Lecture Slides: [[File:02-17-2015.pdf|thumbnail]]
* Lecture Slides: [[File:02-17-2015.pdf|thumbnail]]
* Learning goal: (1) BASH scripting; (2) Homology searching with NCBI blast
* Learning goal: (1) BASH scripting; (2) Homology searching with NCBI blast
Line 186: Line 189:
{| class="wikitable sortable mw-collapsible"
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
|- style="background-color:lightsteelblue;"
! Assignment #3 (<font color="red">Due Wednesday 2/24/2016, at 10am - Submit Responses on Blackboard</font>)
! Assignment #3 (<font color="red">Due Wednesday 3/1/2017, at 10am - Submit Responses on Blackboard</font>)
|- style="background-color:powderblue;"
|- style="background-color:powderblue;"
| '''Assignment''' (10 pts)<br>
| '''Assignment''' (10 pts)<br>
Line 216: Line 219:
|}
|}


===February 24. Genomics (3). Genome BLAST & BioPerl===
===March 1. Genomics (3). Genome BLAST & BioPerl===
* Lecture Slides: [[File:Session-4-small-2015.pdf|thumbnail]]
* Lecture Slides: [[File:02-24-2016.pdf|thumbnail]]
* Learning goals: Homology, BLAST, & Object-oriented programming with Perl
* Learning goals: Homology, BLAST, & Object-oriented programming with Perl
* BLAST tutorial 2. Find homologs within the new genome itself
 
*BLAST tutorial 1. A single unknown sequence against a reference genome.
*Run Stand-alone BLAST:
* Add blast binaries to your $PATH in ".bash_profile": export PATH=$PATH:/data/biocs/b/bio425/ncbi-blast-2.2.30+/bin/
<syntaxhighlight lang=bash" line enclose="div">
cp ../../bio425/data/GBB.pep ~/. # Copy the reference genome
cp ../../bio425/data/unknown.pep ~/. # Copy the query sequence
makeblastdb -in GBB.pep -dbtype prot -parse_seqids -out ref # make a database of reference genome
blastp -query unknown.pep -db ref # Run simple protein blast
blastp -query unknown.pep -db ref -evalue 1e-5 # filter by E values
blastp -query unknown.pep -db ref -evalue 1e-5 -outfmt 6 # concise output
blastp -query unknown.pep -db ref -evalue 1e-5 -outfmt 6 | cut -f2 > homologs-in-ref.txt # save a list of homologs
blastdbcmd -db ref -entry_batch homologs-in-ref.txt > homologs.pep # extract homolog sequences
</syntaxhighlight>
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
* BLAST tutorial 2.  
*Find homologs within the new genome itself
<syntaxhighlight lang=bash" line start=9 enclose="div">
<syntaxhighlight lang=bash" line start=9 enclose="div">
cp ../../bio425/data/N40.pep ~/. # Copy the unknown genome
cp ../../bio425/data/N40.pep ~/. # Copy the unknown genome
Line 226: Line 246:
blastdbcmd -db N40 -entry_batch homologs-in-N40.txt >> homologs.pep # append to homolog sequences
blastdbcmd -db N40 -entry_batch homologs-in-N40.txt >> homologs.pep # append to homolog sequences
</syntaxhighlight>
</syntaxhighlight>
* BLAST tutorial 3. Multiple alignment & build a phylogeny
* BLAST tutorial 3.  
*Multiple alignment & build a phylogeny
<syntaxhighlight lang=bash" line start= 13 enclose="div">
<syntaxhighlight lang=bash" line start= 13 enclose="div">
../../bio425/bin/muscle -in homologs.pep -out homologs.aln # align sequences
../../bio425/bin/muscle -in homologs.pep -out homologs.aln # align sequences
Line 235: Line 256:
{| class="wikitable sortable mw-collapsible"
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
|- style="background-color:lightsteelblue;"
!Assignment #4 (<font color="red">Due Wednesday 3/2/2016, at 10am - Submit Responses on Blackboard</font>)
!Assignment #4 (<font color="red">Due Wednesday 3/8/2017, at 10am - Submit Responses on Blackboard</font>)
|-style="background-color:powderblue;"
|-style="background-color:powderblue;"
|'''BLAST exercise''' (5 pts)<br>
|'''BLAST exercise''' (5 pts)<br>
* Reading Material: [[File:02-17-2016-BLAST-1.pdf|thumbnail]]
* Reading Material: [[File:02-17-2016-BLAST-1.pdf|thumbnail]]
* Reading Material: [[File:02-17-2016-BLAST-2.pdf|thumbnail]]|  
* Reading Material: [[File:02-17-2016-BLAST-2.pdf|thumbnail]]
* [http://www.woolfit.net/perl/classindex.html Useful Perl tutorial for future classes and homework !]
* Reading Material: [[File:Perl-Strings.pdf|thumbnail]]
* Reading Material: [[File:Perl-Lists-Hashes.pdf|thumbnail]]
* Reading Material: [[File:Perl-Subroutines.pdf|thumbnail]]
* Reading Material: [[File:Perl-Basic-1.pdf|thumbnail]]
* Reading Material: [[File:Perl-Basic-2.pdf|thumbnail]]
 
* Perl : [https://www.youtube.com/watch?v=IoLVCEr207w a 2.5hr video tutorial !]
Run BLASTp to identify all homologs of BBA18 in the reference genome ("ref").  
Run BLASTp to identify all homologs of BBA18 in the reference genome ("ref").  
# Obtain BBA18 peptide sequence using <code>blastdbcmd -db ref -entry 'BBA18'</code>.  
# Obtain BBA18 peptide sequence using <code>blastdbcmd -db ref -entry 'BBA18'</code>.  
Line 248: Line 277:
''Perl exercise''' (5 pts)<br>
''Perl exercise''' (5 pts)<br>
# Compose a Perl script shown below ("dump-coords.pl" in our files), which uses an array (@genes) to hold information for two genes in the <code>../../bio425/data/mys.coord2</code> file. Each element of the array would be a reference to a hash. The hash reference itself would hold gene information in the following format: e.g., <code>$gene={'id'=>'0001', 'start'=>16, 'end'=>324, 'frame'=>'+1', 'score'=>0.929}</code>. Print the array by using the <code>Dumper</code> function.
# Compose a Perl script shown below ("dump-coords.pl" in our files), which uses an array (@genes) to hold information for two genes in the <code>../../bio425/data/mys.coord2</code> file. Each element of the array would be a reference to a hash. The hash reference itself would hold gene information in the following format: e.g., <code>$gene={'id'=>'0001', 'start'=>16, 'end'=>324, 'frame'=>'+1', 'score'=>0.929}</code>. Print the array by using the <code>Dumper</code> function.
# Write a 2nd version of the the script ("read-coords.pl"). This time, instead of hard-coding gene information within the code, the script will read the <code>../../bio425/data/mys.coord</code> file, save gene features into variables, and dump the same results. The following code helps you to get started:
Do not hard-code the values of the hash within the code only the keys (id, start, stop, frame, score), the script must parse the data for the values from the file!
Tip: read elements of line into array, then construct anonymous hash (with $ not %) hashes using values from the elements of the array, and then push the anonymous hash to the @genes array. Remember you will need an intermediate array which will hold the information for the elements of each line, and will be "reloaded with each line.
Use the following skeleton code :
<syntaxhighlight lang=perl" enclose="div">
<syntaxhighlight lang=perl" enclose="div">
#!/usr/bin/perl
#!/usr/bin/perl
Line 261: Line 292:
# Output          : Coordinates and read frame for each gene
# Output          : Coordinates and read frame for each gene
# ----------------------------------------
# ----------------------------------------
die "Usage: $0 <coord_file>\n" unless @ARGV == 1; # print usage
my @genes; # declare the array
my @genes; # declare the array
while(<>) { # read file from argument
while(<>) { # this means that as long as lines come from the pipe we keep going
   my $line = $_; # save each line to a variable
   my $line = $_; # a line that come from the pipe (we go line by line)
   next unless $line =~ /^\d+/; # skip lines except those reporting genes  
   next unless $line =~ /^\d+/; # skip lines except those reporting genes  
   <Your code: split the $line on white spaces and save into variables>
   <Your code: split the $line on white spaces and save into variables>
Line 274: Line 304:
|}
|}


===March 2: Genomics (4). Object-oriented Perl (Continued) ===
===March 8: Genomics (4). Object-oriented Perl (Continued) ===
* Lecture Slides: [[File:Session-5-Spring-2015-small.pdf|thumbnail|Session 3]]
 
* Lecture Slides: [[File:File-03-09-partA.pdf|thumbnail]]
* Lecture Slides: [[File:File-03-09-partB.pdf|thumbnail]]
 
*Reading material:
* [http://www.woolfit.net/perl/63bioseq.html Perl References 1]
* [http://search.cpan.org/dist/BioPerl/Bio/Seq.pm Perl References and Bio::Seq module]
* [http://www.woolfit.net/perl/classindex.html Perl Overview]
 
* Learning goal: (1) Object-Oriented Perl; (2) BioPerl
* Learning goal: (1) Object-Oriented Perl; (2) BioPerl
* In-Class Exercises
* In-Class Exercises
Line 322: Line 360:
exit;
exit;
</syntaxhighlight>
</syntaxhighlight>
{| class="wikitable sortable mw-collapsible"
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
|- style="background-color:lightsteelblue;"
! Assignment #5 (<font color="red">Due Wednesday 3/9/2016, at 10am - Submit Responses on Blackboard</font>)
! Assignment #5 (<font color="red">Due Wednesday 3/15/2017, at 10am - Submit Responses on Blackboard</font>)
|- style="background-color:powderblue;"
|- style="background-color:powderblue;"
| '''BioPerl exercises (10 pts)'''<br />
| '''BioPerl exercises (10 pts)'''<br />
Perl exercise 1 (if you have submitted this before, please resubmit your earlier answer and note that is a resubmission) (5 pts)<br>
# Compose a Perl script shown below ("dump-coords.pl" in our files), which uses an array (@genes) to hold information for two genes in the <code>../../bio425/data/mys.coord2</code> file. Each element of the array would be a reference to a hash. The hash reference itself would hold gene information in the following format: e.g., <code>$gene={'id'=>'0001', 'start'=>16, 'end'=>324, 'frame'=>'+1', 'score'=>0.929}</code>. Print the array by using the <code>Dumper</code> function.
Do not hard-code the values of the hash within the code only the keys (id, start, stop, frame, score), the script must parse the data for the values from the file!
Tip: read elements of line into array, then construct anonymous hash (with $ not %) hashes using values from the elements of the array, and then push the anonymous hash to the @genes array. Remember you will need an intermediate array which will hold the information for the elements of each line, and will be "reloaded with each line.
Use the following skeleton code :
<syntaxhighlight lang=perl" enclose="div">
#!/usr/bin/perl
use strict;
use warnings;
use Data::Dumper; # print complex data structure
# ----------------------------------------
# Author          : WGQ
# Date            : February 30, 2015
# Description    : Read coord file
# Input          : A coord file
# Output          : Coordinates and read frame for each gene
# ----------------------------------------
my @genes; # declare the array
while(<>) { # this means that as long as lines come from the pipe we keep going
  my $line = $_; # a line that come from the pipe (we go line by line)
  next unless $line =~ /^\d+/; # skip lines except those reporting genes
  <Your code: split the $line on white spaces and save into variables>
  <Your code: construct anonymous hash and push into @genes>
}
print Dumper(\@genes);
exit;
</syntaxhighlight>
Perl exercise 2 (5 pts)<br>
# Write an "extract.pl" using Perl & BioPerl that extract coding sequences from "coord" files. The script will use Bio::SeqIO to read the genome FASTA file ("mystery_seq1.fas", see Assignment #2 above). It will also read the "mystery_seq1.coord" (see Assignment #2 above) as the 2nd argument. Use Bio::Seq to obtain coding sequences and translate sequences. Your output of protein sequences should not contain stop codons except as the last codon. The following template helps you get started:
# Write an "extract.pl" using Perl & BioPerl that extract coding sequences from "coord" files. The script will use Bio::SeqIO to read the genome FASTA file ("mystery_seq1.fas", see Assignment #2 above). It will also read the "mystery_seq1.coord" (see Assignment #2 above) as the 2nd argument. Use Bio::Seq to obtain coding sequences and translate sequences. Your output of protein sequences should not contain stop codons except as the last codon. The following template helps you get started:
<syntaxhighlight lang="perl" line enclose="div">
<syntaxhighlight lang="perl" line enclose="div">
Line 366: Line 436:
exit;
exit;
</syntaxhighlight>
</syntaxhighlight>
|}
|}


===March 9: Course Material Practice and Review - Questions ===
===March 15: Course Material Practice and Review - Questions ===
* Review slides: [[File:Session-6-reviw-sp-15.pdf|thumbnail]]
* Review slides: [[File:Review-Session.pdf|thumbnail]]
* [https://www.dropbox.com/sh/fdy60u8nlzgim8f/AACm6vX2hdhg-JGi7ZeZUyKCa?dl=0 BioPerl Lecture videos]
* [http://search.cpan.org/dist/BioPerl/Bio/SeqIO.pm Perl Doc 1]
* [https://metacpan.org/pod/Bio::SeqIO Perl Doc 2]
* [https://metacpan.org/pod/Bio::Seq#trunc Perl Doc 3]
* [http://bioperl.open-bio.org/wiki/HOWTO:SeqIO Perl Doc 4]
 
* Practice Tests
* Practice Tests
# Browse & Filter "Big Data" files with UNIX filters
# Browse & Filter "Big Data" files with UNIX filters
Line 399: Line 476:
### Sort by "log_a_b_ratio": <code>sort -k5 -n ../../bio425/data/Jill-silac-batch-1.dat</code>
### Sort by "log_a_b_ratio": <code>sort -k5 -n ../../bio425/data/Jill-silac-batch-1.dat</code>
### Show ranking of P53: <code>sort -k5 -n -r ../../bio425/data/Jill-silac-batch-1.dat | cat -n | grep -w "TP53"</code>
### Show ranking of P53: <code>sort -k5 -n -r ../../bio425/data/Jill-silac-batch-1.dat | cat -n | grep -w "TP53"</code>
Important information for solving the homework !
[https://www.dropbox.com/sh/fdy60u8nlzgim8f/AACm6vX2hdhg-JGi7ZeZUyKCa?dl=0 BioPerl Lecture videos]




{| class="wikitable sortable mw-collapsible"
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
|- style="background-color:lightsteelblue;"
! Assignment #1 - (<font color="red">Due Wednesday 2/16/2016, at 10am - Submit Responses on Blackboard</font>)
! Assignment #6 - (<font color="red">Due Wednesday 3/22/2017, at 10am - Submit Responses on Blackboard</font>)
|- style="background-color:powderblue;"
|- style="background-color:powder blue;"
| '''Unix Text Filters''' (10 pts) Show both commands and outputs for the following questions:<br>  
| '''Unix Text Filters''' (5 pts) Show both commands and outputs for the following questions:<br>  
# Identify homologs and build a phylogeny
# Identify homologs and build a phylogeny
## Copy genome file: "../../bio425/data/GBB.1con-splitted/Borrelia_burgdorferi_4075_lp54_plasmid_A.fas" to your home directory as "lp54.fas": <code>cp ../../bio425/data/GBB.1con-splitted/Borrelia_burgdorferi_4075_lp54_plasmid_A.fas lp54.fas</code>
## Copy genome file: "../../bio425/data/GBB.1con-splitted/Borrelia_burgdorferi_4075_lp54_plasmid_A.fas" to your home directory as "lp54.fas": <code>cp ../../bio425/data/GBB.1con-splitted/Borrelia_burgdorferi_4075_lp54_plasmid_A.fas lp54.fas</code>
Line 420: Line 501:
# Review BASH "while" & "for" loops (see Assignment #3)
# Review BASH "while" & "for" loops (see Assignment #3)
# Review the use Bio::SeqIO to read FASTA files and the use Bio::Seq methods to manipulate sequences (see Assignment #5)
# Review the use Bio::SeqIO to read FASTA files and the use Bio::Seq methods to manipulate sequences (see Assignment #5)
|}
----


===March 16. Midterm  ===
'''Perl exercises (5 pts)'''
*Write an "extract.pl" using Perl & BioPerl that extract coding sequences from "coord" files. The script will use Bio::SeqIO to read the genome FASTA file ("mystery_seq1.fas", see Assignment #2 above). It will also read the "mystery_seq1.coord" (see Assignment #2 above) as the 2nd argument. Use Bio::Seq to obtain coding sequences and translate sequences. Your output of protein sequences should not contain stop codons except as the last codon. The following template helps you get started:
 
<syntaxhighlight lang=perl line enclose="div">
!/usr/bin/perl
use strict;
use warnings;
use lib '/data/biocs/b/bio425/bioperl-live';
use Bio::SeqIO;
# ----------------------------------------
# File            : extract.pl
# Author          : WGQ
# Date            : March 5, 2015
# Description    : Emulate glimmer EXTRACT program
# Input          : A FASTA file with 1 DNA seq and coord file from LONG-ORF
# Output          : A FASTA file with translated protein sequences
# ----------------------------------------
die "Usage: $0 <FASTA_file> <coord_file>\n" unless @ARGV > 0;
my ($fasta_file, $coord_file) = @ARGV;
my $fasta_input = Bio::SeqIO->new(<your code>); # create a file handle to read sequences from a file
my $output = Bio::SeqIO->new(-file=>">$fasta_file".".out", -format=>'fasta'); # create a file handle to output sequences into a file
my $seq_obj = $input->next_seq(); # get sequence object from FASTA file
# Read COORD file & extract sequences
open COORD, "<" . $coord_file;
while (<COORD>) {
      my $line = $_;
      chomp $line;
      next unless $line =~ /^\d+/; # skip lines except
      my ($seq_id, $cor1, $cor2, $strand, $score) = split /\s+/, $line; # split line on white spaces
      if (<your code: if strand is positive>) {
        <your code: use trunc function to get sub-sequence as an object>
      } else {
        <your code: use the trunc() function to get sub-sequence as an object>
        <your code: use the revcom() function to reverse-complement the seq object>
      }
      <your code: use translate() function to obtain protein sequence as an abject, "$pro_obj">
      $output->write_seq($pro_obj);
}
close COORD;
exit;
</syntaxhighlight>
 


{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
|-style="background-color:powderblue;"
| (<font color="red">Due Wednesday 2/23/2016, at 10am - Submit Responses on Blackboard</font>)<br>
* The following Perl code dumps nucleotide and codon frequencies given a coding sequence. It is based on the [http://search.cpan.org/~cjfields/BioPerl-1.6.923/Bio/Tools/SeqStats.pm Bio::Tools::SeqStats module of BioPerl]. Copy and run it with <code>./seq-stats.pl ../../bio425/data/B31_ospA.fas</code> to understand its behavior.
* The following Perl code dumps nucleotide and codon frequencies given a coding sequence. It is based on the [http://search.cpan.org/~cjfields/BioPerl-1.6.923/Bio/Tools/SeqStats.pm Bio::Tools::SeqStats module of BioPerl]. Copy and run it with <code>./seq-stats.pl ../../bio425/data/B31_ospA.fas</code> to understand its behavior.
<syntaxhighlight lang=perl line enclose="div">
<syntaxhighlight lang=perl line enclose="div">
Line 454: Line 570:
|}
|}


===March 23 (No Class; College is on a Friday schedule)===
===March 22: Midterm Q&A and review  ===
 
Class meets at the regular time & room, but no new lecture. Instead, bring all the questions
you have for the material we covered so far - we will answer all questions so everyone is well
prepared for completing the midterm.


===March 30: Transcriptome (1): Univariate statistics===
* Learning goals: 1. Microarray technology; 2. Introduction to R
* Lecture Slides: [[File:Session-7-small.pdf|thumbnail]]
* R Tutorial 1
# Set a working directory
## Using a Linux terminal, make a directory called <code>R-work</code>, "cd" into this directory.
## Start R studio: <code>Type "rstudio &" on terminal prompt and hit return</code> ('''Note: This link works only if you use computers in the 1000G lab. Install and use your own R & R Studio for homework assignments''')
## Find working directory with <code>getwd()</code>
# The basic R data structure: Vector
## Construct a character vector with <code>c.vect=c("red", "blue", "green", "orange", "yellow", "cyan")</code>
## Construct a numerical vector with <code>n.vect=c(2, 3, 6, 10, 1, 0, 1, 1, 10, 30)</code>
## Construct vectors using functions
###<code>n.seq1=1:20</code>
###<code>n.seq2=seq(from=1, to=20, by=2)</code>
###<code>n.rep1=rep(1:4, times=2)</code>
###<code>n.rep2=rep(1:4, times=2, each=2)</code>
## Use '''built-in help''' of R functions: <code>?seq</code> or <code>help(seq)</code>
## Find out data class using the '''class''' function: <code>class(c.vect)</code>
# Access vector elements
## A single value: <code>n.vect[2]</code>
## A subset: <code>n.vect[3:6]</code>
## An arbitrary subset: <code>n.vect[c(3,7)]</code>
## Exclusion: <code>n.vect[-8]</code>
## Conditional: <code>n.vect[n.vect>5]</code>
# Apply functions
## Length: <code>length(n.vect)</code>
## Range: <code>range(n.vect); min(n.vect); max(n.vect)</code>
## Descriptive statistics: <code>sum(n.vect); var(n.vect); sd(n.vect)</code>
## Sort: <code>order(n.vect)</code>. How would you get an ordered vector of n.vect? [Hint: use <code>?order</code> to find the return values]
## Arithmetic: <code>n.vect +10; n.vect *10; n.vect / 10</code>
# Quit an R session
## Click on the "History" tab to review all your commands
## Save your commands into a file by opening a new "R Script" and save it as <code>vector.R</code>
## Save all your data to a default file '''.RData''' and all your commands to a default file ".Rhistory" with <code>save.image()</code>
## Quit R-Studio with <code>q()</code>
* R tutorial 2. Data distribution using histogram
# Start a new R studio session and set working directory to <code>~/R-work</code>
# Generate a vector of 100 normal deviates using <code>x.ran=rnorm(100)</code>
# Visualize the data distribution using <code>hist(x.ran)</code>
# Explore help file using <code>?help; example(hist)</code>
# How to break into smaller bins? How to add color? How to change x- and y-axis labels? Change the main title?
# Test if the data points are normally distributed.[Hints: use qqnorm() and qqline()]
# Save a copy of your plot using "Export"->"Save Plot as PDF"
* R tutorial 3. Matrix & Data Frames
# Using a Linux terminal, make a copy of breast-cancer transcriptome file <code>/data/biocs/b/bio425/data/ge.dat</code> in your R working directory
# Start a new R studio session and set working directory to <code>~/R-work</code>
# Read the transcriptome file using <code>ge=read.table("ge.dat", header=T, row.names=1, sep="\t")</code>
## What is the data class of <code>ge</code>?
## Access data frame. What do the following commands return? <code>ge[1,]; ge[1:5,]; ge[,1]; ge[,1:5]; ge[1:5, 1:5]</code>
## Apply functions: <code>head(ge); tail(ge); dim(ge)</code>
# Save a copy of an object: <code>ge.df=ge</code>.
# Transform the transcriptome into a numerical matrix for subsequent operations: <code>ge=as.matrix(ge)</code>
#  Test if the expression values are normally distributed.
# Save and quit the R session
* In class challenge: Replicate normalization in Figure 4.8 (pg 208)
{| class="wikitable sortable mw-collapsible"
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
|- style="background-color:lightsteelblue;"
! Assignment #7 (<font color="red">Due Wednesday 4/6/2016, at 10am - Submit Responses on Blackboard</font>)
! MIDTERM (<font color="red"> Due Wednesday 3/29/2017, at 10am - Submit Responses on Blackboard</font>)
|- style="background-color:powderblue;"
|- style="background-color:powderblue;"
|
 
* (5 pts) Test the "GT-AG" rule of introns. Complete the following script to extract all intron sequences from this file <code>../../bio425/data/mdm2.gb</code>.
| '''Browse & Filter files with UNIX command line (5 pts)'''  <br>
* FASTA file
** List all FASTA files in the "../../bio425/data" directory
** Count number of sequences in a FASTA file: "../../bio425/data/GBB.pep"
** Count number of sequences in all FASTA files in this directory (tips use .../*.fasta or similar)
 
* Gene expression file
** Count the number of lines in "../../bio425/data/ge.dat"
** Count the number of genes in the same file: <code>cut -f .. "</code>
 
* Differentail gene expression file
** Count the nubmer of lines in "../../bio425/data/gene_exp.diff"
** Show head and tail of this file
** Count number of "OK" gene pairs (valid comparisons) with grep of lines that have that, and pipe to count command
** Count number of significantly different genes ("yes" in the end of the file)
** Sort by "log2(fold_change)" - read sort --help to understand options : <code>grep "yes$" ../../bio425/data/gene_exp.diff | cut -f ... | sort -k2 -n</code>
 
* Proteomics file
** Count the number of linse in "../../bio425/data/Jill-silac-batch-1.dat"
** Sort by "log_a_b_ratio". Use the  option of sort that works on specific position / column and also does numeric sorting by reading sort --help: <code>sort  ... ../../bio425/data/Jill-silac-batch-1.dat</code>
** Show ranking of P53, again as above sorting on specific position where the P53 column is and sorting numerically: <code>sort ../../bio425/data/Jill-silac-batch-1.dat | cat -n | grep -w "TP53"</code>
<br>
 
'''Perl exercises (5 pts)'''
Test the "GT-AG" rule of introns. Complete the following script to extract all intron sequences from this file <code>../../bio425/data/mdm2.gb</code>.
** After carefully studying and deciphering the script, replace "?"s (a total of 6) in the script with real numbers
** After carefully studying and deciphering the script, replace "?"s (a total of 6) in the script with real numbers
** Save the script as "splice.pl" & run with the four options individually, as in <code>splice -i mdm2.gb</code>.
** Save the script as "splice.pl" & run with the four options individually, as in <code>splice -i mdm2.gb</code>.
** Make a [http://weblogo.berkeley.edu/ SeqLogo] to show that all introns start with "GT" and ends with "AG". To do so, copy & paste individual sequences at the donor sites [http://weblogo.threeplusone.com/create.cgi into this text box] and click "Create Logo". Print and hand in the resulting image file. Indicate which sites are conserved.  
** Use the output of your script to make a [http://weblogo.berkeley.edu/ SeqLogo] to show that all introns start with "GT" and ends with "AG". To do so, copy & paste individual sequences at the donor sites [http://weblogo.threeplusone.com/create.cgi into this text box] and click "Create Logo". Print and hand in the resulting image file. Indicate which sites are conserved.  
** Repeat for the acceptor-site sequences. Indicate which sites are conserved.
** Repeat for the acceptor-site sequences. Indicate which sites are conserved.
** Please explain what the loop does in lines 25-35. Specifically look at each function in the perl documentation and explain what the function does in the way that is used in these specific lines of code
** Draw a schematic on how the exon - intron - exon structure looks, with the donor and acceptor sites as we've seen in the class. Explain which lines in the code were designed to capture that structure.
**
<syntaxhighlight lang=perl line enclose="div">
<syntaxhighlight lang=perl line enclose="div">
#!/usr/bin/perl -w
#!/usr/bin/perl -w
Line 615: Line 707:
}
}
</syntaxhighlight>
</syntaxhighlight>
* (2 pts) Install [http://streaming.stat.iastate.edu/CRAN/ R (choose a binary distribution)] first and then [http://www.rstudio.com/ R Studio] to your home/laptop computer [No need to show any output. I trust you on this.]
* (4 pts) Make 2 histograms based on the "ge" data set: (a) expression values for a single (any one if fine) selected cell line (cell lines are in columns, using small-sized bins, e.g., "br=100") and (b) expression values for a selected (any one if fine) gene (genes are in rows). Show all R commands and the final plots (label the plot title with cell line or gene name) ['''Notes:''' You need to download a copy of the <code>ge.dat</code> onto your own computer. On Mac, you could run this command: <code>scp your_user_name@eniac.cs.hunter.cuny.edu:ge.dat  ge.dat</code>. On Windows, download and install <code>sftp</code> or<code> WinSCP</code> for file transfer from/to your eniac account.]
* (4 pts) Use the help() and example() functions to learn how to use the which() and grep() functions. Show how to use these two functions, respectively, to display gene expression values for a gene called "ESR1" in the "ge" data set. [Hint: use the rownames() function to obtain gene names of the "ge" data set.]
|}


===April 6: Transcriptome (2): Bi- and Multi-variate statistics===
* Learning goal: (1) multivariate clustering analysis; (2) Classification of breast-cancer subtypes
* Lecture slides: [[File:Session-8-small.pdf|thumbnail]]
* Tutorial 1. Gene filtering
# Open a new R Studio session and set working directory to R-work
# Load the default workspace and plot a histogram of the gene expression using <code>hist(ge, br=100)</code>. Answer the following questions:
## Make sure <code>ge</code> is a matrix class. If not, review the last session on how to make one
## What is the range of gene expression values? Minimum? Maximum? <pre style="white-space: pre-wrap;">range(ge); min(ge); max(ge)</pre>
## Are these values normally distributed? Test using <code>qqnorm</code> and <code>qqline</code>.
## If not, which data range is over-represented? Why? <pre style="white-space: pre-wrap;">Low gene expression values are over-represented, because most genes are NOT expressed in a particular cell type/tissue.</pre>
# '''Discussion Questions:'''
## What does each number represent? <pre style="white-space: pre-wrap;">log2(cDNA)</pre>
## Why is there an over-representation of genes with low expression values? <pre style="white-space: pre-wrap;">Because most genes are not expressed in these cancer cells</pre>
## How to filter out these genes? <pre style="white-space: pre-wrap;">Remove genes that are expressed in low amount in these cells, by using the function pOverA (see below)</pre>
## How to test if the filtering is successful or not? <pre style="white-space: pre-wrap;">Run qqnorm() and qqline()</pre>
# Remove genes that do not vary significantly among breast-cancer cells
## Download the genefilter library from [http://bioconductor.org BioConductor] using the following code <pre style="white-space: pre-wrap;">source("http://bioconductor.org/biocLite.R"); biocLite("genefilter")</pre>
## Load the genefilter library with <code>library(genefilter)</code>
## Create a gene-filter function: <code>f1=pOverA(p=0.5, A=log2(100))</code>. What is the <code>pOverA</code> function? <pre style="white-space: pre-wrap;">Remove genes expressed with lower than log2(100) amount in half of the cells</pre>
## Obtain indices of genes significantly vary among the cells: <code>index.retained=genefilter(ge, f1)</code>
## Get filtered expression matrix: <code>ge.filtered=ge[index.retained, ]</code>. How many genes are left? <pre style="white-space: pre-wrap;">dim(ge.filtered)</pre>
# Test the normality of the filtered data set
## Plot with <code>hist(); qqnorm(); and qqline()</code>. Are the filtered data normally distributed?
## Plot with <code>boxplot(ge.filtered)</code>. Are expression levels distributed similarly among the cells?
* Tutorial 2. Select genes vary the most in gene expression
# Explore the function <code>mad</code>. What are the input and output? <pre style="white-space: pre-wrap;">Input: a numerical array. Output: median deviation</pre>
# Calculate mad for each gene: <code>mad.ge=apply(ge.filtered, MARGIN=1, FUN=mad)</code>
# Obtain indices of the top 100 most variable genes: <code>mad.top=order(mad.ge, decreasing=T)[1:100]</code>
# Obtain a matrix of most variable genes: <code>ge.var=ge.filter[mad.top,]</code>
* Part 3. Classify cancer subtypes based on gene expression levels
# '''Discussion Questions:'''
## How would you measure the difference between a one-dimensional variable? <pre style="white-space: pre-wrap;">d=|x1-x2|</pre>
## How would you measure the difference between a two-dimensional variable? <pre style="white-space: pre-wrap;">d=|x1-x2|+|y1-y2|</pre>
## How would you measure the Euclidean difference between a three-dimensional variable? <pre style="white-space: pre-wrap;">d=|x1-x2|+|y1-y2|+|z1-z2|</pre>
## How would you measure the Euclidean difference between a multi-dimensional variable? <pre style="white-space: pre-wrap;">d=SQRT(sum([xi-xj]^2))</pre>
## To measure similarities between cells based on their gene expression values, is it better to use Euclidean or correlation distances? <pre style="white-space: pre-wrap;">Correlational distance measures similarity in trends regardless of magnitude.</pre>
# Calculate correlation matrix between cells: <code>cor.cell=cor(ge.var)</code>
# Calculate correlation matrix between genes: <code>cor.gene=cor(t(ge.var))</code> What does the t() function do? <pre style="white-space: pre-wrap;">transposition (turn rows into columns and columns into rows)</pre>
# Obtain correlational distances between cells: <code>dg.cell=as.dendrogram(hclust(as.dist(1-cor.cell)))</code>
# Obtain correlational distances between genes: <code>dg.gene=as.dendrogram(hclust(as.dist(1-cor.gene)))</code>
# Plot a heat map: <code>heatmap(ge.var, Colv=dg.cell, Rowv=dg.gene)</code>
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
! Assignment #8 (<font color="red">Due Wednesday 4/13/2016, at 10am - Submit Responses on Blackboard</font>)
|- style="background-color:powderblue;"
|
(10 pts) The following table lists expression levels of a gene measured under an Experimental and a Control conditions, each of which was replicated five times:
{| class="wikitable"
|-
!  !! Experimental !! Control
|-
| Replicate 1 || 606 || 287
|-
| Replicate 2 || 441 || 198
|-
| Replicate 3 || 702 || 366
|-
| Replicate 4 || 597 || 255
|-
| Replicate 5 || 888 || 402
|}
Test significance of gene expressions between the Exp and Ref groups. Show all R commands, test results, & plots.
* Plot a boxplot
* Plot a vertical stripcharts. Why is a stripchart more informative than a boxplot?
* Perform a paired t-test, using the log2 scale. Are gene expression values significantly different between the Exp and Ref groups?
* Plot a scatter plot and add a regression line. Show results of regression analysis, include the R-squared value and the p value. Are the expression levels between the two conditions significantly correlated?
|}
|}


===April 13: Transcriptome (3). RNA-SEQ Analysis===
=== March 29: Population Analysis (1)===
* Learning goal: RNA-SEQ pipeline
* Lecture slides: [[File:Session-9-small.pdf|thumbnail]]
* Read data source [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE32038 GSE32038]
* Tutorial 1. Visualize expression levels
<syntaxhighlight lang="bash" line enclose="div">
gene.fpkm=read.table("../../bio425/data/genes.fpkm_tracking", head=T, sep="\t")
dim(gene.fpkm)
head(gene.fpkm)
fpkm=gene.fpkm[which(gene.fpkm$C1_status=='OK' & gene.fpkm$C2_status=='OK'),] # filter low-quality values
hist(log10(fpkm$C1_FPKM), br=100)
plot(density(log10(fpkm$C1_FPKM)))
plot(log10(fpkm$C1_FPKM), log10(fpkm$C2_FPKM))
fpkm.m=log2(fpkm$C1_FPKM) + log2(fpkm$C2_FPKM)
fpkm.a=log2(fpkm$C1_FPKM) - log2(fpkm$C2_FPKM)
plot(fpkm.m, fpkm.a)
</syntaxhighlight>
* Tutorial 2. Test differential gene expressions
<syntaxhighlight lang="bash" line enclose="div">
gene=read.table("/data/biocs/b/bio425/data/gene_exp.diff", header=T, sep="\t")
dim(gene)
head(gene)
gene.ok=gene[which(gene$status=='OK'),] # filter
gene.sig=gene.ok[which(gene.ok$significant=="yes"),] # select significant genes
plot(gene.ok$log2.fold_change., -log10(gene.ok$q_value)) # volcano plot
plot(gene.ok$log2.fold_change., -log10(gene.ok$q_value), col=gene.ok$significant)
</syntaxhighlight>
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
! Assignment #9 (<font color="red">Due Wednesday 4/20/2016, at 10am - Submit Responses on Blackboard</font>)
|- style="background-color:powderblue;"
|
* (5 pts). Filter genes in the "ge.mat" using the "mad" function. Retain the top 50 most-variable genes. Calculate pairwise gene and cell correlation distances. Plot a heatmap. Answer the following questions:
** What does the "mad" function return? What is the biological rationale to use this function to filter genes, before identifying subtypes among cell lines?
** How many major subtypes of cancer cells and subgroups of genes you could identify, respectively?
** Label the genes as two largest groups (Group 1 & 2 Genes). Similarly, label the largest two groups of cell lines as "Group 1" and "Group 2" cells.  Explain the expression profiles of Group 1 and Group 2 genes in each subgroup of cells. (e.g., "Group 1 genes are up-regulated in Group 1 Cells and down-regulated in Group 2 Cells". Note that the "yellow" is high in heat color and "red" low).
* (5 pts). Transfer the two RNA-SEQ output files ("genes.fpkm_tracking" and "gene_exp.diff", both in the folder "bio425/data/") to your local computer (using "scp"). Make a histogram of the "C2" sample (use the first file), an MA plot to show differences between "C1" and "C2" in FPKM counts (use the first file), and a volcano plot (use the 2nd file). Show all your R commands. How many genes are significantly different between the two conditions (based on the 2nd file)?
|}
 
===April 20: Population Analysis (1)===
* Learning goals: (1) SNP analysis (single-locus), (2) haplotype analysis (multiple loci)
* Learning goals: (1) SNP analysis (single-locus), (2) haplotype analysis (multiple loci)
* Lecture slides: [[File:Session-10.pdf|thumbnail]]
* Lecture slides: [[File:04-06-2016.pdf |thumbnail]]
*[https://www.dropbox.com/home/Public/BIOL425/Apr-12-2016 Lecture Videos Explaining Midterm Perl Code]
Tutorial 1. Extract SNP sites
Tutorial 1. Extract SNP sites
<syntaxhighlight lang="perl" line enclose="div">
<syntaxhighlight lang="perl" line enclose="div">
Line 784: Line 768:
{| class="wikitable sortable mw-collapsible"
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
|- style="background-color:lightsteelblue;"
! Assignment #10 (<font color="red">Due Wednesday 4/27/2016, at 10am - Submit Responses on Blackboard</font>)
! Assignment #7 (<font color="red">Due 4/5/2017, at 10am - Submit Responses on Blackboard</font>)
|- style="background-color:powderblue;"
|- style="background-color:powderblue;"
|
|
* Based on the <code>../../bio425/data/ex3-1.aln</code>,
* Based on the <code>../../bio425/data/ex3-1.aln</code>,
* (5 pts). Analyze alignment by eye: Define "allele", "SNP", and "haplotype". Print out the alignment
* (4 pts). Define "allele", "SNP", and "haplotype" based on the discussion we had in class and the slides. Analyze alignment by eye and do the following:
** Label all SNP sites
** Label all SNP sites
** Count frequency of each of the two alleles at the first SNP site
** Count frequency of each of the two alleles at the first SNP site
Line 796: Line 780:
** Do you expect to see more or less transitons than tranvsersions?  
** Do you expect to see more or less transitons than tranvsersions?  
** More synonymous or nonsynonymous SNPs (if the sequence codes for a protein)?
** More synonymous or nonsynonymous SNPs (if the sequence codes for a protein)?
* (5 pts). Complete the above PERL script by replacing the two question marks. Compare your output to the haplotypes you obtained manually. They should be the same.
* (4 pts). Explain in a few sentences what the Perl code above does in lines 34-40
* (2 pts). Modify the code to use Bio::AlignIO to load the sequences (even if you cannot make it fully working, do your best to write some code that shows that you understand the documentation) and how to add it in the code. For documentation see http://search.cpan.org/dist/BioPerl/Bio/AlignIO.pm 
|}
 
===April 26: Regular Expressions===
* Learning goals: Perl Regular Expressions and Pattern Matching
* Lecture slides: [http://diverge.hunter.cuny.edu/w/images/2/24/4-13-16-Lecture-Slides.pdf Lecture Slides]
 
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
! Assignment #8 (<font color="red">Due Wednesday 5/03/2017, at 10am - Submit Responses on Blackboard</font>)
|- style="background-color:powderblue;"
|
* (5 pts). Write regular expression to parse the requested items below from the [http://www.cs.toronto.edu/~leijiang/ta/mie453/tutorial/tut4/Q52107.swp Swiss Prot file] . It is important that you save the text from the link in a text file, then open the file from within a Perl script (or cat and use while <> in the Perl script), and make the el script to run the regular expression and print the exact results requested below, from within your Perl script.
** Match and print the identifiers that look like "IPR..." from the lines that start with "DR" - just print the identifies, nothing else from the line.
** Match and print the size (line with SQ, size is in amino acids AA) and molecular weight of the sequence (again line with SQ, MW). We want just the numbers, nothing else.
** Match and print just the sequence - last two line lines of the file, with only the "MKKLFAS....."
 
* (5 pts). Write regular expression to parse the requested items below from the [http://www.ncbi.nlm.nih.gov/Sitemap/samplerecord.html NCBI File] It is important that you save the text from the link in a text file, then open the file from within a Perl script (or cat and use while <> in the Perl script), and make the el script to run the regular expression and print the exact results requested below, from within your Perl script.
** The numbers (start and end point) for a complement gene (look for a line that has both "complement" and "gene")
** The complete TITLE (including more than one lines - your regular expression has to match past the \n)
** The Journal volume and year (these are found in parentheses () in the line that has Journal as identifier)
|}
|}


===May 4: Population Analysis (2)===
===May 3: BioPerl Part 2 ===
* Learning goals: Case-Control studies for gene mapping
[http://diverge.hunter.cuny.edu/w/images/f/fa/4-20-16-alt.pdf Lecture Slides]
* Lecture slides: [[File:Session-11-small.pdf|thumbnail]]
* Tutorial 1. Test linkage disequilibrium (LD)
* Tutorial 2. Genome-wide association studies (GWAS)
* Tutorial 3. Test of Hardy-Weinberg equilibrium (for random mating & presence of natural selection)


===May 11: Final Review===
{| class="wikitable sortable mw-collapsible"
* Review slides: [[File: Final-Review-small-bio425-sp-2015.pdf|thumbnail]]
|- style="background-color:lightsteelblue;"
* Tutorial 3. Database access with DBI
! Assignment #9 (<font color="red">Due Wednesday 5/10/2017, at 10am - Submit Responses on Blackboard</font>)
|- style="background-color:powderblue;"
|
* (5 pts). Use the following FASTA sequence as input (copy-paste into a vi file in your terminal) [http://www.cbs.dtu.dk/services/NetGene2/fasta.php FASTA sample] and then write BioPerl code to do the following:
** Open the file with [http://search.cpan.org/dist/BioPerl/Bio/SeqIO.pm Bio:SeqIO] and read it contents
** Print the length of each sequence and the total length of all the sequences that we have in the file
** Print the "description" and "display_id", and any other information from the methods that you see are available by reading the [http://search.cpan.org/dist/BioPerl/Bio/Seq.pm#display_id Bio:Seq] documentation [http://search.cpan.org/dist/BioPerl/Bio/SeqIO.pm Bio:SeqIO]
** What do you observe when you print these information - which part of the FASTA header is printed ?
 
* (5 pts). Use the following Genbank sequence as input (copy-paste into a vi file in your terminal) [http://quma.cdb.riken.jp/help/gbHelp.html GenBank sample] and then write BioPerl code to do the following:
** Read the Genbank file using the Bio:SeqIO and the sequences using Bio::Seq
** Check with a regular expression if the display_id contains "methyltranferase"
** Check if the sequence has the pattern: one or more g's, followed by t and any character repeated three times, followed by at least 2 t's.
** reverse complement the sequence and print the reverse complement
** after reverse complement write to a FASTA file
 
 
|}
 
===May 10: Material Review before FINAL ===
 
* PLEASE FILL IN TEACHER EVALUATIONS: [http://www.hunter.cuny.edu/te '''Teacher's evaluation''']
 
* Review slides 1: [[File: Heikki_perl-bioperl.pdf|thumbnail]]
* Review slides 1: [[File: PasteurBioPerlCourse2005.pdf|thumbnail]]
* Review slides 1: [[File: Perl_BioPerl.pdf|thumbnail]]
* PLEASE FILL TEACHER EVALUATIONS :
* [http://www.hunter.cuny.edu/te '''Teacher's evaluation''']
* [http://www.hunter.cuny.edu/te '''Teacher's evaluation''']
* All make-up assignments due May 20.


===May 18: Final Exam===
===May 17: Final Exam ===
* Reminder: [http://www.hunter.cuny.edu/te '''Teacher's evaluation''']
 
 
{| class="wikitable sortable mw-collapsible"
|- style="background-color:lightsteelblue;"
! FINAL EXAM (10 pts) (<font color="red">Due Wednesday 5/17/2016, at 10am - Submit Responses on Blackboard</font>)
|- style="background-color:powderblue;"
|
* Theoretical questions, grep and regular expression code (5 pts).
** Describe what a BioPerl object is, and give some examples of BioPerl objects and their functions. What is the difference with an instance of an object ? Can we have many instances of an object and what is the difference between the instances ?
** Using the data from this [http://www.cbs.dtu.dk/services/NetGene2/fasta.php FASTA file], and with grep (not with Perl code), print out all the sequence data - be careful !: I need only the sequence data, not the headers. Tip: there is an option in grep to match everything except a specific pattern (read the grep documentation), and we do not want the headers to be matched. The you need to pipe the grep output that contains only sequence to the wc command, and count the number of total bases (the number of letters) for both sequences in the file. Tip: look at the wc documentation to see what the option is to count letters instead of lines.
** Using the data from this [https://www.dropbox.com/s/q8mq1k0y549fsk4/sequence1.gb?dl=0 GenBank file], write Perl code that contains regular expressions that matches the number after the  "GI:" . The code needs to go over every line, and after it gets the number using regular expressions, it needs to add each number in an array and print out the array for the use to see. Note that there are multiple "GI:" numbers.
* (5 pts).
** Describe what is the difference between the Bio::SeqIO an Bio::Seq. Which method / function we use to get sequence objects from Bio::SeqIO and what kind of objects are these ?
** Explain what is the difference between the following in regular expressions and how they are used (feel free to give examples to demonstrate your point): {} $ []  + ()
** Write a regular expression to match the following strings:
*** "act "accct" or "acct"
*** exactly "accct" repeated one to three times
*** CT followed by C or G or T followed by ACG
*** CT followed by CG or T followed by ACG
** Using the data from this [https://www.dropbox.com/s/838glwoueqqhui0/sequence.gb?dl=0 GenBank file], write BioPerl code that reads the file, and generates Bio::Seq objects (tip, you need to read the file using another BioPerl object that then generates the Bio::Seq objects via a specific method for getting each sequence). For each Bio::Seq object use the method that gets that sequence (look at the BioPerl documentation to find how this method is called) and print the length of each sequence (tip, the sequence will be a string). As a bonus, write if possible some additional code that adds up the total length of all the sequences.
 
|}


==General Information==
==General Information==
Line 827: Line 874:
** Manipulate high-volume textual data using UNIX tools, Perl/BioPerl, R, and Relational Database ("Data Visualization")
** Manipulate high-volume textual data using UNIX tools, Perl/BioPerl, R, and Relational Database ("Data Visualization")
* '''Pre-requisites:''' This 3-credit course is designed for upper-level undergraduates and graduate students. Prior experiences in the UNIX Operating System and at least one programming language are required. Hunter pre-requisites are CSCI132 (Practical Unix and Perl Programming) and BIOL300 (Biochemistry) or BIOL302 (Molecular Genetics), or permission by the instructor. '''Warning: This is a programming-based bioinformatics course. Working knowledge of UNIX and Perl is required for successful completion of the course.'''
* '''Pre-requisites:''' This 3-credit course is designed for upper-level undergraduates and graduate students. Prior experiences in the UNIX Operating System and at least one programming language are required. Hunter pre-requisites are CSCI132 (Practical Unix and Perl Programming) and BIOL300 (Biochemistry) or BIOL302 (Molecular Genetics), or permission by the instructor. '''Warning: This is a programming-based bioinformatics course. Working knowledge of UNIX and Perl is required for successful completion of the course.'''
* '''Textbook:''' Gibson & Muse (2009). ''A Primer of Genome Science'' (Third Edition). Sinauer Associates, Inc.
* '''Academic Honesty:''' Hunter College regards acts of academic dishonesty (e.g., plagiarism, cheating on examinations, obtaining unfair advantage, and falsification of records and official documents) as serious offenses against the values of intellectual honesty. The College is committed to enforcing the CUNY Policy on Academic Integrity and will pursue cases of academic dishonesty according to the Hunter College Academic Integrity Procedures.
* '''Academic Honesty:''' Hunter College regards acts of academic dishonesty (e.g., plagiarism, cheating on examinations, obtaining unfair advantage, and falsification of records and official documents) as serious offenses against the values of intellectual honesty. The College is committed to enforcing the CUNY Policy on Academic Integrity and will pursue cases of academic dishonesty according to the Hunter College Academic Integrity Procedures.



Latest revision as of 15:58, 3 May 2017

Computational Molecular Biology (BIOL 425/790.49, Spring 2017)
Instructor: Dr Konstantinos Krampis, Associate Professor of Biology
Room:1000G HN (10th Floor, North Building, Computer Science Department, Linux Lab FAQ)
Class Hours: Wednesdays 10:10 am-12:40 pm
Office Hours & Address: Hours: 10am-12pm on Tuesdays Address: Belfer Research Building, 413 East 69th Street (between York and 1st Avenue), New York, NY 10021. Wednesdays 10:10 am-12:40 pm Direction via Google Map;
IMPORTANT: LINUX INSTRUCTIONS AND ACCESSING COMPUTERS REMOTELY

Course Schedule (All Wednesdays)

February 1. Course overview & Unix tools

  • Course Overview. Lecture slides:
  • Learning Goals: (1) Understand the "Omics" files; (2) Review/Learn Unix tools
  • In-Class Tutorial: Unix file filters
  1. Without changing directory, long-list genome, transcriptome, and proteome files using ls
  2. Without changing directory, view genome, transcriptome, and proteome files using less -S
  3. Using grep, find out the size of Borrelia burgdorferi B31 genome in terms of the number of replicons ("GBB.1con" file)
  4. Using sort, sort the replicons by (a) contig id (3rd field, numerically); and (b) replicon type (4th field)
  5. Using cut, show only the (a) contig id (3rd field); (b) replicon type (4th field)
  6. Using tr, (a) replace "_" with "|"; (b) remove ">"
  7. Using sed, (a) replace "Borrelia" with abbreviation "B."; (b) remove "plasmid" from all lines
  8. Using paste -s, extract all contig ids and concatenate them with ";"
  9. Using a combination of cut and uniq, count how many circular plasmids ("cp") and how many linear plasmids ("lp")
  • In-Class Challenges
  1. Using the "GBB.seq" file, find out the number of genes on each plasmid
grep ">" ../../bio425/data/GBB.seq | cut -c1-4| sort | uniq -c
  1. Using the "ge.dat" file, find out (a) the number of genes; (b) the number of cell lines; (c) the expression values of three genes: ERBB2, ESR1, and PGR
grep -v "Description" ../../bio425/data/ge.dat | wc -l; or:  grep -vc "Description" ../../bio425/data/ge.dat
grep "Description" ../../bio425/data/ge.dat | tr '\t' '\n'| grep -v "Desc" | wc -l
grep -Pw "ERBB2|PGR|ESR1" ../../bio425/data/ge.dat

Reading Material

Lecture slides:


Unix 1a: Unix 1a
Unix 1b: Unix 1b
Unix 2: Unix 2
Unix 3: Unix 3

Assignment #1 - (Due Wednesday 2/08/2017, at 10am - Submit Responses on Blackboard as document with all command line outputs)
Unix Text Filters (10 pts) Show both commands and outputs for the following questions:
Tip1: piping to the wc command (read the help for it !) allows you to do line counts

Tip2: read the help for head command (what does the -n operator do?). If you specify head to get 1000 lines for example, you can then use tail command to get the last 10 of those 1000
Tip3: Reading material should tell you what the tr command does, but also look at tr --help. Can you use cut instead of tr ?

  1. Without changing directory (i.e., remain in your home directory), locate and long-list the genbank file named "GBB.gb" in the course data directory
  2. Count the total number of lines, show the first and last 10 lines of the file. Using a combination of head and tail commands, show only the lines containing the translated protein sequence of the first gene
  3. Count the total number of replicans by extracting lines containing "LOCUS" (case sensitive); sort them by the total number of bases ("bp")
  4. Remove the string "(plasmid" from the above output
  5. Extract the second column (replicon names) from the above output. [Hint: these fields are delimited by an unequal number of spaces, not by tabs. Use tr -s to first squeeze to single space]

February 8. Genomics (1): Gene-Finding

  • Learning goals: (1) Running UNIX programs; (2) Parse text with Perl anonymous hash
  • Lecture slides:
  • In-Class Tutorials
  1. Identify ORFs in a prokaryote genome
    1. Go to NCBI ORF Finder page
    2. Paste in the GenBank Accession: AE000791.1 and click "orfFind"
    3. Change minimum length for ORFs to "300" and click "Redraw". How many genes are predicted? What is the reading frame for each ORF? Coordinates? Coding direction?
    4. Click "Six Frames" to show positions of stop codons (magenta) and start codons (cyan)
  2. Gene finder using GLIMMER
    1. Locate the GLIMMER executables: ls /data/biocs/b/bio425/bin/
    2. Locate Borrelia genome files: ls /data/biocs/b/bio425/data/GBB.1con-splitted/
    3. Predict ORFs: ../../bio425/bin/long-orfs ../../bio425/data/GBB.1con-splitted/Borrelia_burgdorferi_4041_cp9_plasmid_C.fas cp9.coord [Note the two arguments: one input file and the other output filename]
    4. Open output file with cat cp9.coord. Compare results with those from NCBI ORF Finder.
    5. Extract lines with coordinates" grep "^[0-9]" cp9.coord > cp9.coord2
    6. Extract sequences into a FASTA file: ../../bio425/bin/extract ../../bio425/data/GBB.1con-splitted/Borrelia_burgdorferi_4041_cp9_plasmid_C.fas cp9.coord2 > cp9.fas [Note two input files and standard output, which is then redirected (i.e., saved) into a new file]
  3. bioseq
    1. Add bp-utils into $PATH by editing the .bash_profile file and run source .bash_profile
    2. Run bioseq with these options: -l, -n, -c, -r, -t1, -t, -t6, and -s
    3. In-Class Challenge: use bioseq to extract and translate the 1st (+1 frame) and 5th (-1 frame) genes.
cp ../../bio425/data/GBB.1con-splitted/Borrelia_burgdorferi_4041_cp9_plasmid_C.fas cp9.plasmid.fas # copy plasmid sequence
bioseq -s'163,1272' cp9.plasmid.fas | bioseq -t1 # extract first predicted ORF (+1 frame)
bioseq -s'3853,4377' cp9.plasmid.fas | bioseq -r | bioseq -t1 # extract 5th ORF (since it is -1 frame, need to rev-com before translation
Assignment #2 (Due Wednesday 2/15/2017, at 10am - Submit Responses on Blackboard)
UNIX Exercises and Reading Material (10 pts)

Lecture Videos

  1. Using ssh, log into eniac.cs.hunter.cuny.edu & then ssh into another host (e.g. "cslab8") for the exercises - REQUIRED IF YOU ARE WORKING REMOTELY!
  2. Copy data file ../../bio425/data/mystery_seq1.fas into your home directry
  3. Add /data/biocs/b/bio425/bin to your the $PATH variable in the ".bash_profile" file (using vi or emacs).
  4. Run source ~/.bash_profile to activate the above path
  5. Use the long-orf command to predict ORFs on the mystery_seq1. Save resulting coord file as "mystery_seq1.coord".
  6. Extract ONLY the lines containing ORF information into a new file "mystery_seq1.coord2" using grep
  7. Run extract to extract FASTA sequences of all predicted ORFs. Save as "mys.nuc".
  8. Translate "mys.nuc" with bioseq -t1. Save to "mys.pep" (don't be surprised if the 2nd sequence contains internal stop codons)
  9. Use bioseq to extract the ORF sequences, save as "mys.nuc2"
  10. Translate "mys.nuc2" with bioseq -t1. Save to "mys.pep2". This file should NOT contain any internal stop codons.

Note: Show all commands and outputs.To log off, type "exit" twice (first log out of the "cslab" host, 2nd time log off the "eniac" host).


February 15. CANCELLED CLASSES ON A MONDAY SCHEDULE

February 22. Genomics (2): BASH & BLAST

  • Lecture Slides:
  • Learning goal: (1) BASH scripting; (2) Homology searching with NCBI blast
  • In-Class exercises
  1. Build workflow with BASH scripts
#!/usr/bin/bash
bioseq -s"163,1272" cp9.plasmid.fas > gene-0001.nuc;
bioseq -t1 gene-0001.nuc > gene-0001.pep;
exit;

Save the above as "extract-gene-v1.bash". Make it executable with chomd +x extract-gene-v1.bash. Run it with ./extract-gene-v1.bash

  1. Improvement 1. make it work for other genes (by using variables)
#!/usr/bin/bash
id=$1;
begin=$2;
end=$3;
bioseq -s"$begin,$end" cp9.plasmid.fas > gene-$id.nuc;
bioseq -t1 gene-$1.nuc > gene-$id.pep;
exit;

Save the above as "extract-gene-v2.bash". Make it executable with chomd +x extract-gene-v2.bash. Run it with ./extract-gene-v2.bash 0001 163 1272 (Note three arguments). Question: How to modify the code to make it work for genes encoded on the reverse strand?

  1. Improvement 2. make it work for both positive and negative genes (by using an "if" statement)
#!/usr/bin/bash
id=$1;
begin=$2;
end=$3;
strand=$4;
bioseq -s"$begin,$end" cp9.plasmid.fas > gene-$id.nuc;
if [ $strand -gt 0 ]; then
    bioseq -t1 gene-$1.nuc > gene-$id.pep;
else
    bioseq -r gene-$1.nuc > gene-$id.rev;
    bioseq -t1 gene-$1.rev > gene-$id.pep;
fi;
exit;
  1. Improvement 3. Make it read "cp9.coord" as an input file, by using a "while" loop:
#!/usr/bin/bash
cat $1 | grep "^[0-9]" | while read line; do
    id=$(echo $line | cut -f1 -d' '); # run commands and save result to a variable
    x1=$(echo $line | cut -f2 -d' ');
    x2=$(echo $line | cut -f3 -d' ');
    strand=$(echo $line | cut -f4 -d' ');
    if [ $strand -lt 0 ]; then
        bioseq -s"$x2,$x1" cp9.plasmid.fas > gene-$id.nuc;
        bioseq -r gene-$id.nuc > gene-$id.rev;
        bioseq -t1 gene-$id.rev;
    else
        bioseq -s"$x1,$x2" cp9.plasmid.fas > gene-$id.nuc;
        bioseq -t1 gene-$id.nuc;
    fi;
done;
exit;
  1. Run Stand-alone BLAST:
  • Add blast binaries to your $PATH in ".bash_profile": export PATH=$PATH:/data/biocs/b/bio425/ncbi-blast-2.2.30+/bin/
  • BLAST tutorial 1. A single unknown sequence against a reference genome
cp ../../bio425/data/GBB.pep ~/. # Copy the reference genome
cp ../../bio425/data/unknown.pep ~/. # Copy the query sequence
makeblastdb -in GBB.pep -dbtype prot -parse_seqids -out ref # make a database of reference genome
blastp -query unknown.pep -db ref # Run simple protein blast
blastp -query unknown.pep -db ref -evalue 1e-5 # filter by E values
blastp -query unknown.pep -db ref -evalue 1e-5 -outfmt 6 # concise output
blastp -query unknown.pep -db ref -evalue 1e-5 -outfmt 6 | cut -f2 > homologs-in-ref.txt # save a list of homologs
blastdbcmd -db ref -entry_batch homologs-in-ref.txt > homologs.pep # extract homolog sequences
  • In-Class challenges
Assignment #3 (Due Wednesday 3/1/2017, at 10am - Submit Responses on Blackboard)
Assignment (10 pts)

IMPORTANT: Log on your eniac account and then ssh into a "cslab" host (e.g., ssh cslab5). Perform the following tasks without changing directory (i.e., stay in your home directory).


  1. UNIX filter exercises (4 pts)
    1. For the codon file /data/biocs/b/bio425/data/codon.table.T, sort by single-letter code of amino acids
    2. use "grep" to show only codons that start with an "A"
    3. Show all codons for "Arg", without amino acid symbols
    4. Use an editor, compose a BASH script (name it "read-codon.bash") that uses a "while" loop to read each line of this file. First, use "grep -v" to exclude stop codons. Then, create three variables to capture the values of three elements on each line. For each line, print the output in the following format: "AAA codes for Lys (K)".
  2. Exercise for the use of wildcard & BASH "for" loop ( 3 pts)
    1. Long-list (i.e., ls -l) the following file in the "/data/biocs/b/bio425/data/GBB.1con-splitted/" directory: Borrelia_burgdorferi_3615_main.fas (this file contains the main chromosome sequence of the B31 strain of Lyme disease bacteria). Run bioseq -l to find out the length of this sequence.
    2. Without changing directory, long-list ALL files with the ".fas" suffix in the same directory (using wildcard). This command list all replicons (sequences in the .fas files, which are chromosome and 21 plasminds) of this genome.
    3. Write a BASH "for" loop on the command line (do not use an editor) to obtain length of each replicon using bioseq -l
  3. BLAST exercise (3 pts).
    1. Use "blastp" to identify matches of the sequence ../../bio425/data/unknown.pep in the "ref" database (which was created in class), using an e-value cutoff of 1e-10
    2. Show all pairwise alignments
    3. Show output in a tabular format (using "-outfmt 6")
    4. Explain the following blast terms: "Identity", "Positives", and "Expect". [Hint, visit the NCBI BLAST home page and this FAQ].

March 1. Genomics (3). Genome BLAST & BioPerl

  • Lecture Slides:
  • Learning goals: Homology, BLAST, & Object-oriented programming with Perl
  • BLAST tutorial 1. A single unknown sequence against a reference genome.
  • Run Stand-alone BLAST:
  • Add blast binaries to your $PATH in ".bash_profile": export PATH=$PATH:/data/biocs/b/bio425/ncbi-blast-2.2.30+/bin/
cp ../../bio425/data/GBB.pep ~/. # Copy the reference genome
cp ../../bio425/data/unknown.pep ~/. # Copy the query sequence
makeblastdb -in GBB.pep -dbtype prot -parse_seqids -out ref # make a database of reference genome
blastp -query unknown.pep -db ref # Run simple protein blast
blastp -query unknown.pep -db ref -evalue 1e-5 # filter by E values
blastp -query unknown.pep -db ref -evalue 1e-5 -outfmt 6 # concise output
blastp -query unknown.pep -db ref -evalue 1e-5 -outfmt 6 | cut -f2 > homologs-in-ref.txt # save a list of homologs
blastdbcmd -db ref -entry_batch homologs-in-ref.txt > homologs.pep # extract homolog sequences
  • BLAST tutorial 2.
  • Find homologs within the new genome itself
cp ../../bio425/data/N40.pep ~/. # Copy the unknown genome
makeblastdb -in N40.pep -dbtype prot -parse_seqids -out N40 # make a database of the new genome
blastp -query unknown.pep -db N40 -evalue 1e-5 -outfmt 6 | cut -f2 > homologs-in-N40.txt # find homologs in the new genome
blastdbcmd -db N40 -entry_batch homologs-in-N40.txt >> homologs.pep # append to homolog sequences
  • BLAST tutorial 3.
  • Multiple alignment & build a phylogeny
../../bio425/bin/muscle -in homologs.pep -out homologs.aln # align sequences
cat homologs.aln | tr ':' '_' > homologs2.aln
../../bio425/bin/FastTree homologs2.aln > homologs.tree # build a gene tree
../../bio425/figtree &  # view tree (works only in the lab; install your own copy if working remotely)
Assignment #4 (Due Wednesday 3/8/2017, at 10am - Submit Responses on Blackboard)
BLAST exercise (5 pts)

Run BLASTp to identify all homologs of BBA18 in the reference genome ("ref").

  1. Obtain BBA18 peptide sequence using blastdbcmd -db ref -entry 'BBA18'.
  2. Run blastp against the "ref" database with the following e-value cutoffs: 1e-5, 1e-3, and 1e-1. Submit the results for 1e-3 with the "-outfmt 6" option.
  3. Extract all homologs using blastdbcmd
  4. Combine all sequences with cat and align all sequences using muscle. Show alignment.
  5. Build a tree of homologs using FastTree. Display tree with evolview.

Perl exercise' (5 pts)

  1. Compose a Perl script shown below ("dump-coords.pl" in our files), which uses an array (@genes) to hold information for two genes in the ../../bio425/data/mys.coord2 file. Each element of the array would be a reference to a hash. The hash reference itself would hold gene information in the following format: e.g., $gene={'id'=>'0001', 'start'=>16, 'end'=>324, 'frame'=>'+1', 'score'=>0.929}. Print the array by using the Dumper function.

Do not hard-code the values of the hash within the code only the keys (id, start, stop, frame, score), the script must parse the data for the values from the file! Tip: read elements of line into array, then construct anonymous hash (with $ not %) hashes using values from the elements of the array, and then push the anonymous hash to the @genes array. Remember you will need an intermediate array which will hold the information for the elements of each line, and will be "reloaded with each line. Use the following skeleton code :

#!/usr/bin/perl
use strict;
use warnings;
use Data::Dumper; # print complex data structure
# ----------------------------------------
# Author          : WGQ
# Date            : February 30, 2015
# Description     : Read coord file
# Input           : A coord file
# Output          : Coordinates and read frame for each gene
# ----------------------------------------
my @genes; # declare the array
while(<>) { # this means that as long as lines come from the pipe we keep going
  my $line = $_; # a line that come from the pipe (we go line by line)
  next unless $line =~ /^\d+/; # skip lines except those reporting genes 
  <Your code: split the $line on white spaces and save into variables>
  <Your code: construct anonymous hash and push into @genes>
}
print Dumper(\@genes);
exit;

March 8: Genomics (4). Object-oriented Perl (Continued)

  • Learning goal: (1) Object-Oriented Perl; (2) BioPerl
  • In-Class Exercises

Construct and dump a Bio::Seq object

#!/usr/bin/perl -w
use strict;
use lib '/data/biocs/b/bio425/bioperl-live'; 
use Bio::Seq;
use Data::Dumper;
my $seq_obj = Bio::Seq->new( -id => "ospC", -seq =>"tgtaataattcaggaaaaga" );
print Dumper($seq_obj);
exit;

Apply Bio::Seq methods:

my $seq_rev=$seq_obj->revcom()->seq(); # reverse-complement & get sequence string
my $eq_length=$seq_obj->length(); 
my $seq_id=$seq_obj->display_id(); 
my $seq_string=$seq_obj->seq(); # get sequence string
my $seq_translate=$seq_obj->translate()->seq(); # translate & get sequence string
my $subseq1 = $seq_obj->subseq(1,10); # subseq() returns a string
my $subseq2= $seq_obj->trunc(1,10)->seq(); # trunc() returns a truncated Bio::Seq object
  • Challenge 1: Write a BioPerl-based script called "bioperl-exercise.pl". Start by constructing a Bio::Seq object using the "mystery_seq1.fas" sequence. Apply the trunc() method to obtain a coding segment from base #308 to #751. Reverse-complement and then translate the segment. Output the translated protein sequence.
#!/usr/bin/perl -w
use strict;
use lib '/data/biocs/b/bio425/bioperl-live'; 
use Bio::Seq;
my $seq_obj = Bio::Seq->new( -id => "mystery_seq", -seq =>"tgtaataattcaggaaaaga.............." );
print $seq_obj->trunc(308, 751)->revcom()->translate()->seq(), "\n";
exit;
  • Challenge 2. Re-write the above code using Bio::SeqIO to read the "mystery_seq1.fas" sequence and output the protein sequence.
#!/usr/bin/perl -w
use strict;
use lib '/data/biocs/b/bio425/bioperl-live'; 
use Bio::SeqIO;
die "$0 <fasta_file>\n" unless @ARGV == 1;
my $file = shift @ARGV; 
my $input = Bio::Seq->new( -file => $file, -format =>"fasta" );
my $seq_obj = $input->next_seq();
print $seq_obj->trunc(308, 751)->revcom()->translate()->seq(), "\n";
exit;
Assignment #5 (Due Wednesday 3/15/2017, at 10am - Submit Responses on Blackboard)
BioPerl exercises (10 pts)

Perl exercise 1 (if you have submitted this before, please resubmit your earlier answer and note that is a resubmission) (5 pts)

  1. Compose a Perl script shown below ("dump-coords.pl" in our files), which uses an array (@genes) to hold information for two genes in the ../../bio425/data/mys.coord2 file. Each element of the array would be a reference to a hash. The hash reference itself would hold gene information in the following format: e.g., $gene={'id'=>'0001', 'start'=>16, 'end'=>324, 'frame'=>'+1', 'score'=>0.929}. Print the array by using the Dumper function.

Do not hard-code the values of the hash within the code only the keys (id, start, stop, frame, score), the script must parse the data for the values from the file! Tip: read elements of line into array, then construct anonymous hash (with $ not %) hashes using values from the elements of the array, and then push the anonymous hash to the @genes array. Remember you will need an intermediate array which will hold the information for the elements of each line, and will be "reloaded with each line. Use the following skeleton code :

#!/usr/bin/perl
use strict;
use warnings;
use Data::Dumper; # print complex data structure
# ----------------------------------------
# Author          : WGQ
# Date            : February 30, 2015
# Description     : Read coord file
# Input           : A coord file
# Output          : Coordinates and read frame for each gene
# ----------------------------------------
my @genes; # declare the array
while(<>) { # this means that as long as lines come from the pipe we keep going
  my $line = $_; # a line that come from the pipe (we go line by line)
  next unless $line =~ /^\d+/; # skip lines except those reporting genes 
  <Your code: split the $line on white spaces and save into variables>
  <Your code: construct anonymous hash and push into @genes>
}
print Dumper(\@genes);
exit;


Perl exercise 2 (5 pts)

  1. Write an "extract.pl" using Perl & BioPerl that extract coding sequences from "coord" files. The script will use Bio::SeqIO to read the genome FASTA file ("mystery_seq1.fas", see Assignment #2 above). It will also read the "mystery_seq1.coord" (see Assignment #2 above) as the 2nd argument. Use Bio::Seq to obtain coding sequences and translate sequences. Your output of protein sequences should not contain stop codons except as the last codon. The following template helps you get started:
#!/usr/bin/perl
use strict;
use warnings;
use lib '/data/biocs/b/bio425/bioperl-live';
use Bio::SeqIO;
# ----------------------------------------
# File            : extract.pl
# Author          : WGQ
# Date            : March 5, 2015
# Description     : Emulate glimmer EXTRACT program
# Input           : A FASTA file with 1 DNA seq and coord file from LONG-ORF
# Output          : A FASTA file with translated protein sequences
# ----------------------------------------
die "Usage: $0 <FASTA_file> <coord_file>\n" unless @ARGV > 0;
my ($fasta_file, $coord_file) = @ARGV;
my $fasta_input = Bio::SeqIO->new(<your code>); # create a file handle to read sequences from a file
my $output = Bio::SeqIO->new(-file=>">$fasta_file".".out", -format=>'fasta'); # create a file handle to output sequences into a file
my $seq_obj = $input->next_seq(); # get sequence object from FASTA file
# Read COORD file & extract sequences
open COORD, "<" . $coord_file;
while (<COORD>) {
      my $line = $_;
      chomp $line;
      next unless $line =~ /^\d+/; # skip lines except
      my ($seq_id, $cor1, $cor2, $strand, $score) = split /\s+/, $line; # split line on white spaces
      if (<your code: if strand is positive>) {
        <your code: use trunc function to get sub-sequence as an object>
      } else {
        <your code: use the trunc() function to get sub-sequence as an object>
        <your code: use the revcom() function to reverse-complement the seq object>
      }
      <your code: use translate() function to obtain protein sequence as an abject, "$pro_obj">
      $output->write_seq($pro_obj);
}
close COORD;
exit;

March 15: Course Material Practice and Review - Questions

  • Practice Tests
  1. Browse & Filter "Big Data" files with UNIX filters
    1. Genome file
      1. List all FASTA files in the "../../bio425/data" directory: ls ../../bio425/data/*.fas
      2. Count number of sequences in a FASTA file: "../../bio425/data/GBB.pep": grep -c ">" ../../bio425/data/GBB.pep
      3. Count number of sequences in all FASTA file in this directory: grep -c ">" ../../bio425/data/*.fas
      4. Remove directory names from the above output: grep ">" ../../bio425/data/*.fas | sed 's/^.\+data\///' or grep ">" ../../bio425/data/*.fas| cut -f5 -d'/'
    2. GenBank file
      1. Show top 10 lines in "../../bio425/data/mdm2.gb": head ../../bio425/data/mdm2.gb
      2. Show bottom 10 lines: tail ../../bio425/data/mdm2.gb
      3. Extract all lines containing nucleotides: cat ../../bio425/data/mdm2.gb | grep -P "^\s+\d+[atcg\s]+$"
    3. Transcriptome file: a microarray data set
      1. Count the number of lines in "../../bio425/data/ge.dat": wc -l ../../bio425/data/ge.dat
      2. Count the number of genes: cut -f1 ../../bio425/data/ge.dat | grep -vc "Desc"
      3. Count the number of cells: head -1 ../../bio425/data/ge.dat | tr '\t' '\n' | grep -vc "Desc"
    4. Transcriptome file: an RNA-SEQ output file
      1. Count the nubmer of lines in "../../bio425/data/gene_exp.diff": wc -l ../../bio425/data/gene_exp.diff
      2. Show head: head ../../bio425/data/gene_exp.diff
      3. Show tail: tail ../../bio425/data/gene_exp.diff
      4. Count nubmer of "OK" gene pairs (valid comparisons): grep -c "OK" ../../bio425/data/gene_exp.diff
      5. Count nubmer of significantly different genes: grep -c "yes$" ../../bio425/data/gene_exp.diff
      6. Sort by "log2(fold_change)": grep "yes$" ../../bio425/data/gene_exp.diff | cut -f1,10 | sort -k2 -n
    5. A proteomics dataset: SILAC
      1. Count the number of line in "../../bio425/data/Jill-silac-batch-1.dat": wc -l ../../bio425/data/Jill-silac-batch-1.dat
      2. Show top: head ../../bio425/data/Jill-silac-batch-1.dat
      3. Show bottom: wc -l ../../bio425/data/Jill-silac-batch-1.dat
      4. Show results for P53 genes: grep -w "TP53" ../../bio425/data/Jill-silac-batch-1.dat
      5. Sort by "log_a_b_ratio": sort -k5 -n ../../bio425/data/Jill-silac-batch-1.dat
      6. Show ranking of P53: sort -k5 -n -r ../../bio425/data/Jill-silac-batch-1.dat | cat -n | grep -w "TP53"


Important information for solving the homework ! BioPerl Lecture videos


Assignment #6 - (Due Wednesday 3/22/2017, at 10am - Submit Responses on Blackboard)
Unix Text Filters (5 pts) Show both commands and outputs for the following questions:
  1. Identify homologs and build a phylogeny
    1. Copy genome file: "../../bio425/data/GBB.1con-splitted/Borrelia_burgdorferi_4075_lp54_plasmid_A.fas" to your home directory as "lp54.fas": cp ../../bio425/data/GBB.1con-splitted/Borrelia_burgdorferi_4075_lp54_plasmid_A.fas lp54.fas
    2. Identify ORFs in file using "long-orfs": long-orfs lp54.fas lp54.coord
    3. Extract nucleotide sequences: extract lp54.fas lp54.coord > lp54.nuc
    4. Use "bioseq" to translate into peptides, into "lp54.pep": bioseq -t1 lp54.nuc > lp54.pep
    5. Make a blast database: makeblastdb -in lp54.pep -dbtype 'prot' -parse_seqids -out lp54
    6. Copy file "../../bio425/data/BBA68.pep" to your home directory: cp ../../bio425/data/BBA68.pep .
    7. Find homologs of "BBA68.pep" in "lp54.pep" using "blastp": blastp -query BBA68.pep -db lp54 -evalue 1e-5 -outfmt 6 | cut -f2 > BBA68.homologs
    8. Extract all blast homologs using "blastdbcmd": blastdbcmd -db lp54 -entry_batch BBA68.homologs > BBA68.homologs.pep
    9. Align all homologs using "muscle": muscle -in BBA68.homologs.pep -out BBA68.homologs.aligned
    10. Build a tree of BBA65 homologs using "FastTree": FastTree BBA68.homologs.aligned > BBA68.dnd
    11. Show tree with evolview
  2. Review BASH "while" & "for" loops (see Assignment #3)
  3. Review the use Bio::SeqIO to read FASTA files and the use Bio::Seq methods to manipulate sequences (see Assignment #5)

Perl exercises (5 pts)

  • Write an "extract.pl" using Perl & BioPerl that extract coding sequences from "coord" files. The script will use Bio::SeqIO to read the genome FASTA file ("mystery_seq1.fas", see Assignment #2 above). It will also read the "mystery_seq1.coord" (see Assignment #2 above) as the 2nd argument. Use Bio::Seq to obtain coding sequences and translate sequences. Your output of protein sequences should not contain stop codons except as the last codon. The following template helps you get started:
!/usr/bin/perl
use strict;
use warnings;
use lib '/data/biocs/b/bio425/bioperl-live';
use Bio::SeqIO;
# ----------------------------------------
# File            : extract.pl
# Author          : WGQ
# Date            : March 5, 2015
# Description     : Emulate glimmer EXTRACT program
# Input           : A FASTA file with 1 DNA seq and coord file from LONG-ORF
# Output          : A FASTA file with translated protein sequences
# ----------------------------------------
die "Usage: $0 <FASTA_file> <coord_file>\n" unless @ARGV > 0;
my ($fasta_file, $coord_file) = @ARGV;
my $fasta_input = Bio::SeqIO->new(<your code>); # create a file handle to read sequences from a file
my $output = Bio::SeqIO->new(-file=>">$fasta_file".".out", -format=>'fasta'); # create a file handle to output sequences into a file
my $seq_obj = $input->next_seq(); # get sequence object from FASTA file
# Read COORD file & extract sequences
open COORD, "<" . $coord_file;
while (<COORD>) {
      my $line = $_;
      chomp $line;
      next unless $line =~ /^\d+/; # skip lines except
      my ($seq_id, $cor1, $cor2, $strand, $score) = split /\s+/, $line; # split line on white spaces
      if (<your code: if strand is positive>) {
        <your code: use trunc function to get sub-sequence as an object>
      } else {
        <your code: use the trunc() function to get sub-sequence as an object>
        <your code: use the revcom() function to reverse-complement the seq object>
      }
      <your code: use translate() function to obtain protein sequence as an abject, "$pro_obj">
      $output->write_seq($pro_obj);
}
close COORD;
exit;


  • The following Perl code dumps nucleotide and codon frequencies given a coding sequence. It is based on the Bio::Tools::SeqStats module of BioPerl. Copy and run it with ./seq-stats.pl ../../bio425/data/B31_ospA.fas to understand its behavior.
#!/usr/bin/perl -w
use strict;
use lib '/data/biocs/b/bio425/bioperl-live';
use Bio::Tools::SeqStats;
use Bio::SeqIO;
use Data::Dumper;
die "Usage: $0 <fasta>\n" unless @ARGV == 1;
my $filename = shift @ARGV;
my $in = Bio::SeqIO->new(-file=>$filename, -format=>'fasta');
my $seqobj = $in->next_seq();
my $seq_stats = Bio::Tools::SeqStats->new($seqobj);
my $monomers = $seq_stats->count_monomers();
my $codons = $seq_stats->count_codons();
print Dumper($monomers, $codons);
exit;
  • Write a Perl code ("my-seq-stats.pl") to emulate its two methods ("count_monomers" & "count_codons") with the following specific requirements:
    • Read the fasta file with Bio::SeqIO
    • Write a subroutine named as "count_monomers" to count and print the frequency of each nucleotide (in percentage), sorted by nucleotide type. The argument for the subroutine would be the sequence as a string, as in count_monomers($seqobj->seq). The return value would be a reference to a hash (the same as the $monomers in the above code).
    • Hint: use hash to count unique bases, see Perl Cookbook example, especially the code listed under "4.6.2.4. Faster but different"
  • In a similar way, write a subroutine named as "count_codons" to count and print the frequency of each codon, sorted by codons. Your codon counts should be the same as those produced by the listed code.

March 22: Midterm Q&A and review

Class meets at the regular time & room, but no new lecture. Instead, bring all the questions you have for the material we covered so far - we will answer all questions so everyone is well prepared for completing the midterm.

MIDTERM ( Due Wednesday 3/29/2017, at 10am - Submit Responses on Blackboard)
Browse & Filter files with UNIX command line (5 pts)
  • FASTA file
    • List all FASTA files in the "../../bio425/data" directory
    • Count number of sequences in a FASTA file: "../../bio425/data/GBB.pep"
    • Count number of sequences in all FASTA files in this directory (tips use .../*.fasta or similar)
  • Gene expression file
    • Count the number of lines in "../../bio425/data/ge.dat"
    • Count the number of genes in the same file: cut -f .. "
  • Differentail gene expression file
    • Count the nubmer of lines in "../../bio425/data/gene_exp.diff"
    • Show head and tail of this file
    • Count number of "OK" gene pairs (valid comparisons) with grep of lines that have that, and pipe to count command
    • Count number of significantly different genes ("yes" in the end of the file)
    • Sort by "log2(fold_change)" - read sort --help to understand options : grep "yes$" ../../bio425/data/gene_exp.diff | cut -f ... | sort -k2 -n
  • Proteomics file
    • Count the number of linse in "../../bio425/data/Jill-silac-batch-1.dat"
    • Sort by "log_a_b_ratio". Use the option of sort that works on specific position / column and also does numeric sorting by reading sort --help: sort ... ../../bio425/data/Jill-silac-batch-1.dat
    • Show ranking of P53, again as above sorting on specific position where the P53 column is and sorting numerically: sort ../../bio425/data/Jill-silac-batch-1.dat | cat -n | grep -w "TP53"


Perl exercises (5 pts)

  • Test the "GT-AG" rule of introns. Complete the following script to extract all intron sequences from this file ../../bio425/data/mdm2.gb.
    • After carefully studying and deciphering the script, replace "?"s (a total of 6) in the script with real numbers
    • Save the script as "splice.pl" & run with the four options individually, as in splice -i mdm2.gb.
    • Use the output of your script to make a SeqLogo to show that all introns start with "GT" and ends with "AG". To do so, copy & paste individual sequences at the donor sites into this text box and click "Create Logo". Print and hand in the resulting image file. Indicate which sites are conserved.
    • Repeat for the acceptor-site sequences. Indicate which sites are conserved.
    • Please explain what the loop does in lines 25-35. Specifically look at each function in the perl documentation and explain what the function does in the way that is used in these specific lines of code
    • Draw a schematic on how the exon - intron - exon structure looks, with the donor and acceptor sites as we've seen in the class. Explain which lines in the code were designed to capture that structure.
#!/usr/bin/perl -w

use strict;
use lib '/data/biocs/b/bio425/bioperl-live';
use Bio::SeqIO;
use Data::Dumper;
use Getopt::Std;
# ----------------------------------------
# Author          : WGQ
# Date            : April 2, 2015
# Description     : Extract intron, exon, and junction sequences
# Input           : A GenBank file containing introns
# Output          : A Fasta file to feed into WebLogo
# Gene Model      : ---exon[i]-donor[i]-intron[i]-acceptor[i]-exon[i+1]-donor[i+1]-intron[i+1]-acceptor[i+1]---
# ----------------------------------------
# Part 1. Read 4 options & genbank file
my %opts;
getopts("eida", \%opts); # process options
die "Usage: $0 [-e(xon) -i(ntron) --d(onor) --a(cceptor)] <a GenBank file>\n" unless @ARGV == 1 && ($opts{e} || $opts{i} || $opts{d} || $opts{a}); # print usage if no input file or no options given
my $gb = shift @ARGV;
my $in = Bio::SeqIO->new(-file=>$gb, -format=>'genbank');
my $seq = $in->next_seq();
my (@exons, @introns, @donors, @acceptors); # declare arrays as data contains

# Part 2. Extract exon information
foreach my $feat ( $seq->get_SeqFeatures() ) { # loop through each genbank feature
    next unless $feat->primary_tag() eq "mRNA"; # skip unless the feature is tagged as "mRNA"
    my $location_obj = $feat->location(); # splice coordinates saved as a Bio::Location::Split object
    my $exon_id = 1;
    foreach my $loc ($location_obj->each_Location) { # access each exon coords object
        push @exons, {
            'order' => $exon_id++,
            'start' => $loc->start,
            'end' => $loc->end
        };
    }
}

# print Dumper(\@exons); exit; # uncomment to see results of parsed exons

# Part 3. Calcuate intron, donor, acceptor objects
## Extract introns coords:
for (my $i=0; $i<$#exons; $i++) { # for each exon
    push @introns, {
        'order' => $exons[$i]->{order},
        'start' => $exons[$i]->{end}+1, # intron i starts at (exon i)'s end + 1
        'end' => $exons[$i+1]->{start}-1, # intron i ends at (exon i+1)'s start -1
    };
}

# print Dumper(\@introns); exit; # uncomment to see introns

## Donor sites (-10 to -1 of an exon and 1-20 of intron)
for (my $i=0; $i<$#exons; $i++) {
    push @donors, {
        'order' => $exons[$i]->{order},
        'start' => $exons[$i]->{end} - ?, # donor i starts at (exon i)'s -10 to -1
        'end' => $introns[$i]->{start} + ?, # donor i ends at (intron i+1)'s 1 to 20
    };
}

# print Dumper(\@donors); exit; # uncomment to see donor sequences

## Acceptor sites (-20 to -1 of an intron and 1-10 of exon)
for (my $i=0; $i<$#exons; $i++) {
    push @acceptors, {
        'order' => $exons[$i]->{order},
        'start' => $introns[$i]->{end} - ?, # acceptor i starts at (intron i)'s -20 to -1
        'end' => $exons[$i+1]->{start} + ?, # acceptor i ends at (exon i+1)'s 1 to 10
    };
}

# print Dumper(\@acceptors); exit; # uncomment to see acceptor sequences

# Part 4. Output sequences
&print_seq("intron", \@introns) if $opts{i};
&print_seq("exon", \@exons) if $opts{e};
&print_seq("donor", \@donors) if $opts{d};
&print_seq("acceptor", \@acceptors) if $opts{a};

exit;

sub print_seq {
    my ($tag, $ref) = @_;
    my @bins = @$ref;
    foreach my $bin (@bins) {
        my $out = Bio::SeqIO->new(-format=>'fasta');
        my $seq =$seq->trunc(?, ?);
        $seq->id($tag . "_" . $bin->{order});
        $out->write_seq($seq);
    }
}

March 29: Population Analysis (1)

Tutorial 1. Extract SNP sites

#!/usr/bin/perl
# Author: WGQ
# Description: Examine each alignment site as a SNP or constant
# Input:  a DNA alignment
# Output: a haplotypes alignemnt
use strict;
use warnings;
use Data::Dumper;

# Part I. Read file and store NTs in a hash (use Bio::AlignIO to read an alignment is better)
my %seqs; # declare a hash as sequence container
my $length;
while (<>) { # read file line by line
  my $line = $_;
  chomp $line;
  next unless $line =~ /^seq/; # skip lines unless it starts with "seq"
  my ($id, $seq) = split /\s+/, $line; # split on white spaces
  $seqs{$id} = [ (split //, $seq) ]; # id as key, an array of nts as value
  $length = length($seq);
}

my %is_snp; # declare a hash to store status of alignment columns
# Part II. Go through each site and report status
for (my $pos = 0; $pos < $length; $pos++) {
  my %seen_nt; # declare a hash to get counts of each nt at a aligned position
  foreach my $id (keys %seqs) { # collect and count all nts at an aligned site
    my $nt =  $seqs{$id}->[$pos];
    $seen_nt{$nt}++;
  }
  my @key_nts = keys %seen_nt;
  if (@key_nts > 1) { # a SNP site has more than two nucelotdies
    $is_snp{$pos} = 1;
  } else { # a constant site
    $is_snp{$pos} = 0;
  }
}

# Part III. Print haplotypes (i.e., nucleotides at SNP sites for each chromosome)
foreach my $id (keys %seqs) { # for each chromosome
  print $id, "\t";
  for (my $pos = 0; $pos < $length; $pos++) { # for each site
    next unless $is_snp{$pos}; # skip constant site
    print $seqs{$id}->[$pos]; # print nt at a SNP site
  }
  print "\n";
}

exit;

Tutorial 2. Hardy-Weinberg Equilibrium: Calculate expected genotype frequencies

Assignment #7 (Due 4/5/2017, at 10am - Submit Responses on Blackboard)
  • Based on the ../../bio425/data/ex3-1.aln,
  • (4 pts). Define "allele", "SNP", and "haplotype" based on the discussion we had in class and the slides. Analyze alignment by eye and do the following:
    • Label all SNP sites
    • Count frequency of each of the two alleles at the first SNP site
    • List all haplotypes, and count frequency of each haplotype.
    • How many SNP (i.e., variable) sites you expect to see in a window of DNA containing 10K bases among humans?
    • How many nucleotide states (2, 3, or 4) you expect to see for an individual SNP site?
    • Do you expect to see more or less transitons than tranvsersions?
    • More synonymous or nonsynonymous SNPs (if the sequence codes for a protein)?
  • (4 pts). Explain in a few sentences what the Perl code above does in lines 34-40
  • (2 pts). Modify the code to use Bio::AlignIO to load the sequences (even if you cannot make it fully working, do your best to write some code that shows that you understand the documentation) and how to add it in the code. For documentation see http://search.cpan.org/dist/BioPerl/Bio/AlignIO.pm

April 26: Regular Expressions

  • Learning goals: Perl Regular Expressions and Pattern Matching
  • Lecture slides: Lecture Slides
Assignment #8 (Due Wednesday 5/03/2017, at 10am - Submit Responses on Blackboard)
  • (5 pts). Write regular expression to parse the requested items below from the Swiss Prot file . It is important that you save the text from the link in a text file, then open the file from within a Perl script (or cat and use while <> in the Perl script), and make the el script to run the regular expression and print the exact results requested below, from within your Perl script.
    • Match and print the identifiers that look like "IPR..." from the lines that start with "DR" - just print the identifies, nothing else from the line.
    • Match and print the size (line with SQ, size is in amino acids AA) and molecular weight of the sequence (again line with SQ, MW). We want just the numbers, nothing else.
    • Match and print just the sequence - last two line lines of the file, with only the "MKKLFAS....."
  • (5 pts). Write regular expression to parse the requested items below from the NCBI File It is important that you save the text from the link in a text file, then open the file from within a Perl script (or cat and use while <> in the Perl script), and make the el script to run the regular expression and print the exact results requested below, from within your Perl script.
    • The numbers (start and end point) for a complement gene (look for a line that has both "complement" and "gene")
    • The complete TITLE (including more than one lines - your regular expression has to match past the \n)
    • The Journal volume and year (these are found in parentheses () in the line that has Journal as identifier)

May 3: BioPerl Part 2

Lecture Slides

Assignment #9 (Due Wednesday 5/10/2017, at 10am - Submit Responses on Blackboard)
  • (5 pts). Use the following FASTA sequence as input (copy-paste into a vi file in your terminal) FASTA sample and then write BioPerl code to do the following:
    • Open the file with Bio:SeqIO and read it contents
    • Print the length of each sequence and the total length of all the sequences that we have in the file
    • Print the "description" and "display_id", and any other information from the methods that you see are available by reading the Bio:Seq documentation Bio:SeqIO
    • What do you observe when you print these information - which part of the FASTA header is printed ?
  • (5 pts). Use the following Genbank sequence as input (copy-paste into a vi file in your terminal) GenBank sample and then write BioPerl code to do the following:
    • Read the Genbank file using the Bio:SeqIO and the sequences using Bio::Seq
    • Check with a regular expression if the display_id contains "methyltranferase"
    • Check if the sequence has the pattern: one or more g's, followed by t and any character repeated three times, followed by at least 2 t's.
    • reverse complement the sequence and print the reverse complement
    • after reverse complement write to a FASTA file


May 10: Material Review before FINAL

May 17: Final Exam

FINAL EXAM (10 pts) (Due Wednesday 5/17/2016, at 10am - Submit Responses on Blackboard)
  • Theoretical questions, grep and regular expression code (5 pts).
    • Describe what a BioPerl object is, and give some examples of BioPerl objects and their functions. What is the difference with an instance of an object ? Can we have many instances of an object and what is the difference between the instances ?
    • Using the data from this FASTA file, and with grep (not with Perl code), print out all the sequence data - be careful !: I need only the sequence data, not the headers. Tip: there is an option in grep to match everything except a specific pattern (read the grep documentation), and we do not want the headers to be matched. The you need to pipe the grep output that contains only sequence to the wc command, and count the number of total bases (the number of letters) for both sequences in the file. Tip: look at the wc documentation to see what the option is to count letters instead of lines.
    • Using the data from this GenBank file, write Perl code that contains regular expressions that matches the number after the "GI:" . The code needs to go over every line, and after it gets the number using regular expressions, it needs to add each number in an array and print out the array for the use to see. Note that there are multiple "GI:" numbers.
  • (5 pts).
    • Describe what is the difference between the Bio::SeqIO an Bio::Seq. Which method / function we use to get sequence objects from Bio::SeqIO and what kind of objects are these ?
    • Explain what is the difference between the following in regular expressions and how they are used (feel free to give examples to demonstrate your point): {} $ [] + ()
    • Write a regular expression to match the following strings:
      • "act "accct" or "acct"
      • exactly "accct" repeated one to three times
      • CT followed by C or G or T followed by ACG
      • CT followed by CG or T followed by ACG
    • Using the data from this GenBank file, write BioPerl code that reads the file, and generates Bio::Seq objects (tip, you need to read the file using another BioPerl object that then generates the Bio::Seq objects via a specific method for getting each sequence). For each Bio::Seq object use the method that gets that sequence (look at the BioPerl documentation to find how this method is called) and print the length of each sequence (tip, the sequence will be a string). As a bonus, write if possible some additional code that adds up the total length of all the sequences.

General Information

Course Description

  • Background: Biomedical research is becoming a high-throughput science. As a result, information technology plays an increasingly important role in biomedical discovery. Bioinformatics is a new interdisciplinary field formed between molecular biology and computer science.
  • Contents: This course will introduce both bioinformatics theories and practices. Topics include: database searching, sequence alignment, molecular phylogenetics, structure prediction, and microarray analysis. The course is held in a UNIX-based instructional lab specifically configured for bioinformatics applications.
  • Problem-based Learning (PBL): For each session, students will work in groups to solve a set of bioinformatics problems. Instructor will serve as the facilitator rather than a lecturer. Evaluation of student performance include both active participation in the classroom work as well as quality of assignments (see #Grading Policy).
  • Learning Goals: After competing the course, students should be able to perform most common bioinformatics analysis in a biomedical research setting. Specifically, students will be able to
    • Approach biological questions evolutionarily ("Tree-thinking")
    • Evaluate and interpret computational results statistically ("Statistical-thinking")
    • Formulate informatics questions quantitatively and precisely ("Abstraction")
    • Design efficient procedures to solve problems ("Algorithm-thinking")
    • Manipulate high-volume textual data using UNIX tools, Perl/BioPerl, R, and Relational Database ("Data Visualization")
  • Pre-requisites: This 3-credit course is designed for upper-level undergraduates and graduate students. Prior experiences in the UNIX Operating System and at least one programming language are required. Hunter pre-requisites are CSCI132 (Practical Unix and Perl Programming) and BIOL300 (Biochemistry) or BIOL302 (Molecular Genetics), or permission by the instructor. Warning: This is a programming-based bioinformatics course. Working knowledge of UNIX and Perl is required for successful completion of the course.
  • Academic Honesty: Hunter College regards acts of academic dishonesty (e.g., plagiarism, cheating on examinations, obtaining unfair advantage, and falsification of records and official documents) as serious offenses against the values of intellectual honesty. The College is committed to enforcing the CUNY Policy on Academic Integrity and will pursue cases of academic dishonesty according to the Hunter College Academic Integrity Procedures.

Grading Policy

  • Treat assignments as take-home exams. Student performance will be evaluated by weekly assignments and projects. While these are take-home projects and students are allowed to work in groups and answers to some of the questions are provided in the back of the textbook, students are expected to compose the final short answers, computer commands, and code independently. There are virtually an unlimited number of ways to solve a computational problem, as are ways and personal styles to implement an algorithm. Writings and blocks of codes that are virtually exact copies between individual students will be investigated as possible cases of plagiarism (e.g., copies from the Internet, text book, or each other). In such a case, the instructor will hold closed-door exams for involved individuals. Zero credits will be given to ALL involved individuals if the instructor considers there is enough evidence for plagiarism. To avoid being investigated for plagiarism, Do NOT copy from others or let others copy your work.
  • Submit assignments on the Blackboard Email attachments will NOT be accepted. Assignments will not be allowed past the due date and time and will be graded as zero. Each assignment will be graded based on timeliness (10%), whether executable or having major errors (50%), algorithm efficiency (10%), and readability in programming styles (30%, see #Assignment Expectations).
  • The grading scheme
    • Assignments (100 pts): 10 exercises.
    • Mid-term (50 pts).
    • Final Project (50 pts)
    • Classroom performance (50 pts): Active engagement in classroom exercises and discussions
    • Attendance (50 pts): 1 unexcused absences = 40; 2 absences = 30; More than 2 = 0.

Assignment Expectations

  • Use a programming editor (e.g., vi, emacs, sublime) so you could have features like automatic syntax highlighting, indentation, and matching of quotes and parenthesis.
  • All PERL code must begin with "use strict; and use warnings;" statements. For each assignment, unless otherwise stated, I would like the full text of the source code. Since you cannot print using the text editor in the lab (even if you are connected from home), you must copy and paste the code into a word processor or a local text editor. If you are using a word processor, change the font to a fixed-width/monospace font. On Windows, this is usually Courier.
  • Also, unless otherwise stated, both the input and the output of the program must be submitted as well. This should also be in fixed-width font, and you should label it in such a way so that I know it is the program's input/output. This is so that I know that you've run the program, what data you have used, and what the program produced. If you are working from the lab, one option is to email the code to yourself, change the font, and then print it somewhere else as there is no printer in the lab.
  • Recommended Style
  • Bad Style

Useful Links

Unix Tutorials

Perl Help

  • Professor Stewart Weiss has taught CSCI132, a UNIX and Perl class. His slides go into much greater detail and are an invaluable resource. They can be found on his course page here.
  • Perl documentation at perldoc.perl.org. Besides that, running the perldoc command before either a function (with the -f option ie, perldoc -f substr) or a perl module (ie, perldoc Bio::Seq) can get you similar results without having to leave the terminal.

Regular Expression

Bioperl

SQL