Mini-Tutorals: Difference between revisions
imported>Lab (→Step 6) |
|||
| (203 intermediate revisions by 4 users not shown) | |||
| Line 1: | Line 1: | ||
=Exploratory sequence analysis in R (seqinr package)= | |||
* Help page: https://cran.r-project.org/web/packages/seqinr/refman/seqinr.html | |||
* Gene family databases: https://doua.prabi.fr/main/index | |||
* Tutorial: | |||
* Hogenom: bacterial (13 phylum) homolog databases: http://hogenom.univ-lyon1.fr/ | |||
=Genome viewer= | |||
# geneviewer is an R package https://wiki.genometracker.org/index.php?title=Mini-Tutorals&action=edit§ion=1for plotting gene clusters and transcripts. It imports data from GenBank, FASTA, and GFF files, perform... | |||
# Ref: https://nvelden.github.io/geneviewer/articles/geneviewer.html | |||
<syntaxhighlight lang="bash"> | |||
library(geneviewer) | |||
gbk <- read_gbk("cp26.gbf", features = "CDS") | |||
cds_df <- gbk_features_to_df( | |||
gbk, | |||
feature = "CDS", | |||
keys = c("locus_tag", "region", "gene", "protein_id", "gene_kind", "product"), | |||
process_region = TRUE | |||
) | |||
gc.plot <- GC_chart(cds_df, cluster = "cluster", group = "gene", width = "1000px", height = "200px") %>% | |||
GC_labels() |> | |||
GC_scaleBar(title = "1 kb", scaleBarUnit = 1000, y=30) %>% | |||
GC_legend(group = "product") | |||
# Save plot to temp.html file | |||
htmlwidgets::saveWidget(gc.plot, "temp.html", selfcontained = TRUE) | |||
# Save plot to .png (or .jpg, .jpeg, .webp, .pdf) | |||
webshot2::webshot( | |||
"temp.html", | |||
"cp26-gbk.pdf", | |||
vwidth = 1500, | |||
vheight = 300, | |||
zoom = 1, # Increase zoom for higher resolution | |||
selector = ".geneviewer") | |||
</syntaxhighlight> | |||
=Weblogo= | |||
* install weblogo from [https://github.com/WebLogo/weblogo github] | |||
* Or install with conda: <code>conda install -c conda-forge weblogo</code> | |||
* Or install with pip: <code>pip install weblogo</code> | |||
* run the following command | |||
<syntaxhighlight lang="bash"> | |||
weblogo -f IR4-pep.fas -o ir4-logo.pdf -D fasta -F pdf -A protein -s large -t "IR4" -c chemistry | |||
</syntaxhighlight> | |||
=Tree visual with ggtree= | |||
* Ref book: https://yulab-smu.top/treedata-book/ | |||
<syntaxhighlight lang="sas"> | |||
setwd("C:/Users/Weigang/Dropbox/Natasha-files/") | |||
library(ggtree) | |||
library(treeio) | |||
library(tidyverse) | |||
# read tree | |||
tree <- read.tree("asian_clade3_v2.nwk") | |||
# create a tibble of OTU groups | |||
tips <- tibble(id = tree$tip.label, | |||
origin = c(rep("Eurasia",4), "US", "Eurasia", | |||
"US", rep("Eurasia",25))) | |||
# plot tree | |||
p <- ggtree(tree) + | |||
xlim(0,0.02) + # to avoid overflow of labels | |||
geom_treescale(x=0, y=30) | |||
# join tree and add group color | |||
p %<+% tips + | |||
geom_tiplab(aes(color = origin)) + | |||
scale_color_manual(values = c("Eurasia" = 1, "US" = 2)) + | |||
theme(legend.position = "none") | |||
</syntaxhighlight> | |||
=Github for sharing data and source code= | |||
* SSH setup (github no longer allows password-based push to remote repository) | |||
# [https://docs.github.com/en/github/authenticating-to-github/connecting-to-github-with-ssh/generating-a-new-ssh-key-and-adding-it-to-the-ssh-agent Create a new SSH key on your computer] | |||
# [https://docs.github.com/en/github/authenticating-to-github/connecting-to-github-with-ssh/adding-a-new-ssh-key-to-your-github-account Add the key to your Github account] | |||
# [https://gist.github.com/xirixiz/b6b0c6f4917ce17a90e00f9b60566278 Commit with SSH] | |||
## Authentication/test: <code>ssh -T git@github.com</code> | |||
## Add repository for commit: <code>git remote set-url origin git@github.com:bioperl/p5-bpwrapper.git</code> | |||
* Developer workflow | |||
** Clone remote repository: <code>git clone <rep-name.git></code> | |||
** Sync local to remote repository: <code>git pull</code> | |||
** Check local repository status: <code>git status</code> | |||
** Show the latest commit: <code>git log</code> | |||
** Add new file: <code>git add <filename> </code> | |||
** Commit changes to local repository: <code>git commit -a -m "message"</code> | |||
** Push to remote repository: <code>git push</code> | |||
=bcftools pipeline= | |||
bcftools view -m2 -M2 --types snps calls.bcf > snps.bcf | |||
vcftools --vcf snps4.vcf --maf 0.01 --recode --recode-INFO-all --out maf (n=33 SNPs) | |||
bcftools query -l maf.recode.vcf > samples (n=17775 samples) | |||
cat samples | while read line; do echo ">$line"; bcftools query -s "$line" -f '[%TGT]' maf.recode.vcf; echo; done > samples-maf.fas | |||
=R tips= | |||
==Phylogeny with data== | |||
* Phylosignal (an alternative to ggtree): https://cran.r-project.org/web/packages/phylosignal/vignettes/Demo_plots.html | |||
==R one-liners with <code>-e 'EXPR'</code>== | |||
<syntaxhighlight lang='bash'> | |||
# capture numbers in the "tmp" file and then run R: | |||
R -e 'mean(scan(file = "tmp")); q()' | |||
</syntaxhighlight> | |||
==Add binomial test with mutate== | |||
<syntaxhighlight lang='bash'> | |||
get_conf <- function(cts, sum){ | |||
dat <- tibble(cts) | |||
names(dat) <- c('cts') | |||
out <- lapply(1:nrow(dat), function(y){ | |||
t <- binom.test(dat$cts[y], sum); | |||
lo <- t$conf.int[1]; | |||
hi <- t$conf.int[2]; | |||
return(c(lo, hi))} | |||
) | |||
return(out) | |||
} | |||
df.hill.fix <- df.hill.fix |> mutate(fix.prob = fix.cts/50, | |||
conf.lo = sapply(get_conf(fix.cts, 50), \(x) x[1]), | |||
conf.hi = sapply(get_conf(fix.cts, 50), \(x) x[2]) | |||
) | |||
df.hill.fix <- df.hill.fix |> | |||
mutate(rec.rate = case_when( | |||
c == 0 ~ 'Nc = 0', | |||
c == 1/800 ~ "Nc = 1/4", | |||
c == 1/200 ~ "Nc = 1", | |||
c == 1/50 ~ "Nc = 4", | |||
)) | |||
df.hill.fix |> | |||
ggplot(aes(x = s+0.01, y = fix.prob, color = rec.rate )) + | |||
geom_point() + | |||
geom_line(linetype = 1) + | |||
scale_x_log10() + | |||
xlab("sel coef at B/b locus") + | |||
ylab("fixation prob of A allele") + | |||
geom_errorbar(aes(ymin = conf.lo, ymax = conf.hi), width = 0.05) + | |||
theme_bw() | |||
</syntaxhighlight> | |||
==Add expected normal curvce to histogram== | |||
<syntaxhighlight lang='bash'> | |||
plot.trait <- function(qt.out) { | |||
phe <- qt.out[[4]]$phe | |||
exp.mean <- qt.out[['trait.exp']][1] | |||
exp.sd <- sqrt(qt.out[['trait.exp']][2]) | |||
x <- seq(min(phe), max(phe), length = 100) | |||
fun <- dnorm(x, mean = exp.mean, sd = exp.sd) | |||
hist(phe, probability = T, ylim = c(0, max(fun)), br = 50, las = 1) | |||
lines(x, fun, col = 2, lwd = 2) | |||
} | |||
</syntaxhighlight> | |||
==Run batch contingency table tests== | |||
# Numbered list item | |||
<syntaxhighlight lang='bash'> | |||
snp_ct <- snp_long %>% group_by(POS, geno, virulence) %>% count() | |||
# get pos with < 4 entries: | |||
bad_pos <- snp_ct %>% group_by(POS) %>% count() %>% filter(n < 4) | |||
library(broom) | |||
# batch fisher's exact test | |||
snp_fisher <- snp_long %>% | |||
filter(!POS %in% bad_pos$POS) %>% | |||
group_by(POS) %>% | |||
do(tidy(xtabs(~geno + virulence, data = .) %>% | |||
fisher.test(simulate.p.value = T))) | |||
snp_fisher <- snp_fisher %>% mutate(y = -log10(p.value)) | |||
# plot vocano | |||
snp_fisher %>% | |||
ggplot(aes(x = estimate, y = y)) + | |||
geom_point(shape = 1, alpha = 0.5) + | |||
scale_x_log10() + | |||
geom_vline(xintercept = 1, linetype = 2, color = "red") + | |||
theme_bw() + | |||
xlab("odds ratio (log10)") + | |||
ylab("signficance (-log10[p])") | |||
</syntaxhighlight> | |||
==multiple regression models (with broom::tidy)== | |||
<syntaxhighlight lang='bash'> | |||
library(broom) | |||
compensation.models <- compensation %>% group_by(Grazing) %>% do(tidy(lm(Fruit ~ Root, data = .))) %>% filter(term != '(Intercept)') | |||
</syntaxhighlight> | |||
==multiple regression models (with nested tibble)== | |||
<syntaxhighlight lang="bash"> | |||
# returns a list of models: | |||
mods <- test |> | |||
group_by(gene_id) |> | |||
nest() |> | |||
mutate(model = lapply(data, \(df) lm(log.cts ~ genotype * treat, data = df))) | |||
est.ia <- predict(df.mod$models[[1]], newdata = data.frame(mean.val = c(df.boot.mean |> filter(stat == 'Ia') |> pull(mean.val))), se.fit = T) | |||
exp(est.ia$fit) | |||
exp(est.ia$se.fit) | |||
# get p vals | |||
pvals <- lapply(mods$model, \(x) { | |||
pout <- anova(x)$`Pr(>F)` | |||
return(list(p.geno = pout[1], p.treat = pout[2], p.int = pout[3])) | |||
}) | |||
df.pval <- bind_rows(pvals) | |||
</syntaxhighlight> | |||
<syntaxhighlight lang='bash'> | |||
# build multiple models, one for each serum: | |||
by_serum <- two_od %>% group_by(Serum) %>% nest() # nested data frame, one row per serum | |||
x_model <- function(df) { # model function (similar to lapply) | |||
x <- df %>% filter(OspC!='A02' & OspC!='A04') | |||
# x <- df %>% filter(OspC!='A02' & OspC!='A04' & OspC!='N14') | |||
lm(OD1 ~ OD2, data = x) | |||
} | |||
by_serum <- by_serum %>% mutate(model = map(data, x_model)) # add model to each serum | |||
output <- vector("list") | |||
for(i in 1:length(by_serum$Serum)) { | |||
df <- by_serum$data[[i]] | |||
model <- by_serum$model[[i]] | |||
pd <- predict.lm(model, newdata = data.frame(OD2 = df$OD2)) | |||
output[[i]] <- data.frame(OspC = df$OspC, | |||
OD2 = df$OD2, | |||
OD1 = df$OD1, | |||
OD1_pred = pd, | |||
Serum = rep(by_serum$Serum[i], nrow(df)) | |||
) | |||
} | |||
df.out <- bind_rows(output) | |||
</syntaxhighlight> | |||
==multiple regression models (with custum functions)== | |||
<syntaxhighlight lang='bash'> | |||
# build model | |||
models <- xy %>% split(.$Serum) %>% map(~lm( aff_PL ~ aff_C3H, data= .)) | |||
# get r-squared: | |||
models %>% map(summary) %>% map_dbl("adj.r.squared") | |||
# get p values (of slope, using a custom function): | |||
get.pvalue <- function(x){ | |||
s <- summary(x); | |||
s$coefficients[2, 4] | |||
} | |||
models %>% map(get.pvalue) %>% unlist() | |||
# get slope: | |||
get.slope <- function(x){ | |||
s <- summary(x); | |||
s$coefficients[2, 1] | |||
} | |||
models %>% map(get.slope) %>% unlist() | |||
# get intercept: | |||
get.intercept <- function(x){ | |||
s <- summary(x); | |||
s$coefficients[1, 1] | |||
} | |||
models %>% map(get.intercept) %>% unlist() | |||
</syntaxhighlight> | |||
=Microbial genome alignment with MUMMER4 and other tools= | |||
==SARS-CoV-2 GISAID pipleline== | |||
<pre> | |||
####################################### | |||
# Parse GISAID sequences fasta | |||
###################################### | |||
1. bioseq -B cov.fas # burst into individual files | |||
1a. move the un-bursted file out the "human-files" directory!!! | |||
mv cov-human.fas ../ | |||
2. sam align (weigang@wallace:~/cov-03-09-2030/host-human$ for f in *.fas; do ../sam-align.bash $f; done ) | |||
nucmer --sam-long=COH1 B111.fa COH1.fa | |||
samtools view -b COH1.sam -T B111.fa > COH1.bam | |||
samtools sort COH1.bam -o COH1.sorted.bam | |||
samtools index COH1.sorted.bam | |||
with script: for f in *.fas; do ../sam-align.bash $f; done | |||
3c. Less strict call: bcftools mpileup -Ou -f ../ref.fas *.sorted.bam | bcftools call -mv --ploidy-file ploidy.txt -Ob -o calls.bcf -P 0.05 (or -P 0.1; large P value for less strict call, default 1.1e-3) | |||
# 3b. bcftools mpileup -Ou -f ../ref.fas *.sorted.bam | bcftools call -mv --ploidy-file ploidy.txt -Ob -o calls.bcf, with default ploidy as 1: | |||
weigang@wallace:~/cov-03-09-2020/cov57$ cat ploidy.txt | |||
* * * M 1 | |||
6a. bcftools view -m2 -M2 --types snps calls.bcf > snps.bcf ( get only biallelic SNPs) | |||
6b. vcftools --vcf input_file.vcf --remove-indels --recode --recode-INFO-all --out cov.vcf # filter SNPs only | |||
7. filter sites by allele counts: only informative sites | |||
bcftools view snps.bcf > snps.vcf | |||
vcftools --vcf snps.vcf --mac 2 --recode --recode-INFO-all --out snps2.vcf | |||
</pre> | |||
==Pipeline== | |||
<pre> | |||
###################### | |||
Host & Enviroment: wqiu@bioit.hunter.cuny.edu | |||
vcftools & clonalframe "source activate gbs" | |||
bcftools: "source activate ngs" | |||
1. align fastq to ref | |||
1) index reference genome | |||
bwa index B111.fa | |||
=> 5 files: amb, ann, bwt, pac, sa | |||
2) align reads to ref | |||
ls -1 *.gz | cut -d'.' -f1 | sort -u > sample.list | |||
byobu | |||
cat sample.list | while read line; do bwa mem B111.fa ${line}.R1.fastq.gz ${line}.R2.fastq.gz > $line.sam; done | |||
=> sam file | |||
2. convert to bam, sort by ref coordinates | |||
cat sample.list | while read line; do samtools view -F 4 -Sbh ${line}.sam | samtools sort -o ${line}.bam; done | |||
=> acc.bam | |||
1+2: wrapped to save space | |||
cat sample.list | while read line; do | |||
begin=$(date +"%D:%H:%M") | |||
echo -ne "$line ... started $begin ..."; | |||
bwa mem B111.fa ${line}.clean.1.fastq.gz ${line}.clean.2.fastq.gz > $line.sam 2> /dev/null; | |||
bwa_time=$(date +"%D:%H:%M") | |||
echo -ne "sam file generated: $line.sam on $bwa_time ..."; | |||
samtools view -F 4 -Sbh ${line}.sam | samtools sort -o ${line}.bam 2> /dev/null; | |||
bam_time=$(date +"%D:%H:%M") | |||
echo -ne "bam file generated: $line.bam on $bam_time ..."; | |||
rm $line.sam; | |||
echo "sam file deleted. Done"; | |||
done | |||
3. index | |||
cat sample.list | while read line; do samtools index ${line}.bam; done | |||
=> acc.bam.bai | |||
4. Variant Call | |||
1) make ploidy.txt file | |||
cat > ploidy.txt | |||
* * * M 1 | |||
2) pileup and make bcf file | |||
bcftools mpileup -Ou -f B111.fa *.bam | bcftools call -mv --ploidy-file ploidy.txt -Ob -o calls.bcf -P 0.05 | |||
((or -P 0.1; large P value for less strict call, default 1.1e-3)) | |||
=> calls.bcf | |||
5. analyse calls.bcf; remove outlier SNPs and samples | |||
1) check stats | |||
bcftools stats calls.bcf > call.stats | |||
ts/tv (transition/transversion) better greater than 3 | |||
check AF freq, remove the first class if necessary (e.g., vcf --maf 0.008) | |||
check counts: | |||
vcftools --vcf snps.vcf --counts --out snps | |||
Filter by maf counts (at least 2): | |||
vcftools --vcf snps-255.recode.vcf --recode --recode-INFO-all --out snps2 --mac 2 | |||
2) get only biallelic SNPs | |||
bcftools view -m2 -M2 --types snps calls-87.bcf > snps-87.vcf | |||
bcftools stats snps.vcf | ll | |||
bcftools view -m2 -M2 --types snps call-49.vcf > snps-49.vcf | |||
3) merge samples | |||
bgzip snps-87.vcf | |||
bgzip snps-49.vcf | |||
=> vcf.gz file | |||
bcftools index snps-87.vcf.gz | |||
bcftools index snps-49.vcf.gz | |||
=> vcf.gz.csi file | |||
bcftools merge -Ob snps-87.vcf.gz snps-49.vcf.gz > snps-136.bcf | |||
get only biallelic SNPs | |||
bcftools view -m2 -M2 --types snps snps-136.bcf > snps-136.vcf | |||
ln -s snps-136.vcf snps.vcf | |||
# use vcftools to remove invariant sites, in case samples are dropped: | |||
vcftools --gzvcf snps2.vcf.gz --non-ref-ac-any 1 --recode --recode-INFO-all --out tmp --remove-indv IND | |||
6. vcf to fasta | |||
1) modify sample name (should use "bcftools reheader -s change-id.txt -o tmp.vcf snps.vcf") | |||
cat snps.vcf | sed 's/.bam//g; s/.sorted//g; s/batch-..//g' > tmp.vcf | |||
mv tmp.vcf snps-136.vcf | |||
2) sample list | |||
bcftools query -l snps.vcf > sample.txt | |||
3) make fasta: could be gzipped | |||
cat sample.txt | while read line; do echo ">$line"; bcftools query -s "$line" -f '[%TGT]' snps.vcf; echo; done > sample.fas | |||
Note: . in fas file means missing nt, handled correctly iqtree | |||
4) get ref seq | |||
echo ">B31" > ref.fas | |||
ll snps.vcf => get ref id | |||
grep "^Chromosome" snps.vcf | cut -f4 | paste -s -d '' - >> ref.fas | |||
#grep "^CP021772" snps.vcf | cut -f4 | paste -s -d '\0' - >> ref.fas (#if on apple system) | |||
cat ref.fas >> sample.fas | |||
=> 137 samples, 46783 snps | |||
go to genometracker: | |||
scp sample.fas snps-136.vcf weigang@genometracker.org:/mnt/bac_genome/GBS-Wu-Oct-2022/. | |||
on genometracker: | |||
ln -s snps-136.vcf snps.vcf | |||
# subset samples (e.g., bbss only): | |||
bcftools view -Ov -S samples-bbss.txt --force-samples snp5-lp17.vcf > snp5-lp17-bbss.vcf | |||
7. make tree (with iqtree, for SNP-only alignment, with bootstrap; can't have constant sites) | |||
iqtree2 -s sample.fas -m GTR+ASC -B 1000 -nt AUTO (-n AUTO to use all CPUs on the cluster) | |||
# if containing full seq alignment with constant sites, e.g., HIV env gene alignment | |||
# iqtree -s $work_dir/test.fas -m GTR+F+G -B 1000 --redo -nt AUTO | |||
=> sample.fas.contree | |||
8. consequence call | |||
1) download ref in genbank format | |||
NCBI nucleotide database: search CP021772 | |||
=> B111.gb | |||
2) convert genbank to gff3 format | |||
(1) py file: modified from https://dmnfarrell.github.io/bioinformatics/bcftools-csq-gff-format | |||
=> gb2gff3.py | |||
(2) ./gb2gff3.py B111.gb | |||
=> B111.gff3 | |||
(3) change acc to match ref name in snps.vcf | |||
cat B111.gff3 | sed 's/^CP021772.1/CP021772/' > tmp.gff3 | |||
mv tmp.gff3 B111.gff3 | |||
3) call consequence (to tsv or bcf files) | |||
bcftools csq -f B111.fa -g B111.gff3 snps.vcf -Ot -o snps-csq.tsv | |||
cut -f2,5,6 snps-csq.tsv | tr '|' '\t' | cut -f1-5,7- > snps-csq2.tsv | |||
9. web development | |||
1) orf info from genbank | |||
perl get-orf-by-acc.pl CP021772 > orf.csv | |||
2) | |||
scp weigang@genometracker.org:/mnt/bac_genome/GBS-Wu-Oct-2022/sample.fas.contree . | |||
#biotree -m sample.fas.contree | biotree --ref 'B111' > sample.dnd | |||
#biotree -r 'GBS02' sample.fas.contree | biotree --ref 'B111' > sample.dnd | |||
#biotree -E 0.005 sample.fas.contree | biotree -r 'GBS02' | biotree --ref 'B111' > sample.dnd | |||
biotree -D 90 sample.fas.contree | biotree -r 'GBS02' | biotree --ref 'B111' > tree.dnd | |||
tree visualization by R or PhyloView or R/ggtree | |||
3) | |||
scp weigang@genometracker.org:/mnt/bac_genome/GBS-Wu-Oct-2022/snps-csq2.tsv . | |||
4) pheno.csv | |||
</pre> | |||
== clonal frame pipeline (WGS)== | |||
# Reconstitute whole-genome alignment from vcf; following this post: https://gatk.broadinstitute.org/hc/en-us/community/posts/360070002671-converting-multisample-vcf-to-fasta. Algorithm: split vcf into single-sample vcf's; use "bcftools consensus" to obtain alternate ref seqs. Environment: conda activate ngs (on bioit) | |||
## create one-sample vcf's | |||
cat ../samples-bbss.txt | while read line; do bcftools view -Ov -s $line ../bbss-cp26.vcf.gz > snp5-cp26-$line.vcf; done | |||
## bgzip & tabit | |||
for f in *.vcf; do bgzip $f; tabix $f.gz; done (or bcftools index) | |||
for f in snp5-lp54-*.vcf; do bgzip $f; bcftools index $f.gz; done | |||
## Get consensus | |||
From doc: "Create consensus sequence by applying VCF variants to a reference fasta file. By default, the program will apply all ALT variants to the reference fasta to obtain the consensus sequence. Using the --sample (and, optionally, --haplotype) option will apply genotype (haplotype) calls from FORMAT/GT." | |||
tail -27 ../samples-bbss.txt | while read line; do cat ../../B31-files/cp26_plasmid.fasta | bcftools consensus --sample $line snp5-cp26-$line.vcf.gz | sed "s/>cp26/>$line/" > bbss-cp26-$line.fa; done | |||
## Add reference: | |||
cat ../../B31-files/cp26_plasmid.fasta | sed "s/>cp26/>B31/" > bbss-cp26-B31.fa | |||
concatenate & check length: | |||
cat *.fa > wgs-cp26.fasta | |||
bioseq -l wgs-cp26.fasta | |||
check with bioaln for variability | |||
conda activate gbs | |||
bioaln -i 'fasta' -m wgs-cp26.fasta | less | |||
# run ClonalFrame (conda env "gbs") | |||
srun ClonalFrameML ss-cp26.dnd wgs-cp26.fasta wgs_cp26 -kappa 4.00 -emsim 100 | |||
== Align two assemblies== | |||
# With minimap2: https://github.com/lh3/minimap2 | |||
<code>minimap2 -ax asm5 ref.fa asm.fa > aln.sam # assembly to assembly/ref alignment</code><br> | |||
"For cross-species full-genome alignment, the scoring system needs to be tuned according to the sequence divergence."<br> | |||
"-au options: asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5% sequence divergence" | |||
# With MUMMER4 ([https://mummer4.github.io MUMMER4]): align two genomes, output delta file: | |||
## nucmer -p A909-COH1 COH1.fa A909.fa | |||
## dnadiff -p A909-COH1 -d A909-COH1.delta | |||
## less A909-ref.report, OR <code> grep AvgIdentity A909-ref.report </code> | |||
## output sam file | |||
## nucmer --sam-long=COH1 B111.fa COH1.fa | |||
## samtools view -b COH1.sam -T B111.fa > COH1.bam | |||
## samtools sort COH1.bam -o COH1.sorted.bam | |||
## samtools index COH1.sorted.bam | |||
# Use GSAlign | |||
<pre> | |||
conda config --add channels defaults | |||
conda config --add channels bioconda | |||
conda config --add channels conda-forge | |||
conda install gsalign | |||
gsalign index ref.fas cov | |||
gsalign -i cov -q test.fas | |||
</pre> | |||
# bcf annotate with gff file: | |||
<code>bcftools csq -f ../ensembl-B31-downloads/lp54.fa -g ../ensembl-B31-downloads/lp54.gff3 -Ov -o lp54.anno.vcf lp54.vcf<code> | |||
# variant call with bcftools: https://samtools.github.io/bcftools/howtos/variant-calling.html | |||
# bcftools cheatsheet: https://gist.github.com/elowy01/93922762e131d7abd3c7e8e166a74a0b | |||
=BERT classifier= | |||
* Project start: Winter 2020 | |||
* Project team: Saadmanul Islam <Saadmanul.Islam91@myhunter.cuny.edu> | |||
* Tutorial page: https://medium.com/swlh/a-simple-guide-on-using-bert-for-text-classification-bbf041ac8d04 | |||
* Data set: bioluminascence | |||
* Goal: cross validation | |||
=Estimate LD50 using GLM= | |||
<syntaxhighlight lang='bash'> | |||
## curves | |||
library(dplyr) | |||
library(ggplot2) | |||
library(growthcurver) | |||
library(reshape2) | |||
library(purrr) | |||
setwd("/Users/desireepante/Desktop/Programming") | |||
OD20<-read.csv("OD_0220.csv") | |||
OD220<-OD20[-c(6,11:12,20,26:28, 32:33,45:47),] | |||
od <- filter(OD220, IPTG == 0); | |||
#N15 | |||
od15d <- mutate(od15d, od.norm = OD/max(OD)) | |||
test.1<-glm(min ~ OD, data= od15d, family= "binomial") | |||
ilink<-family(test.1)$linkinv | |||
test.1.pd <- with(od15d, | |||
data.frame(min = seq(min(min), max(min), | |||
length = 10))) | |||
test.1.pd <- cbind(test.1.pd, predict(test.1, test.1.pd, type = "link", se.fit = TRUE)[1:2]) | |||
test.1.pd <- transform(test.1.pd, Fitted = ilink(fit), Upper = ilink(fit + ( se.fit)), | |||
Lower = ilink(fit - ( se.fit))) | |||
test.test<-ggplot(od15d, aes(x = min, y = od.norm)) + | |||
geom_ribbon(data = test.1.pd, aes(ymin = Lower, ymax = Upper, x = min), | |||
fill = "steelblue2", alpha = 0.2, inherit.aes = FALSE) + | |||
geom_line(data = test.1.pd, aes(y = Fitted, x = min)) + | |||
geom_point() | |||
test.test | |||
</syntaxhighlight> | |||
=1k genome project/VCFTools= | |||
<syntaxhighlight lang="bash"> | |||
# Extract APOL1 locus | |||
vcftools --gzvcf ALL.chr22.phase3_shapeit2_mvncall_integrated_v5a.20130502.genotypes.vcf.gz --from-bp 36253071 --to-bp 36267530 --recode --stdout --recode-INFO-all --chr 22 | gzip -c > apol1.vcf.gz | |||
# allele frequencies/counts | |||
vcftools --vcf pvt1.recode.vcf --keep AFR.supergroup --counts --out afr | |||
# pi | |||
# Fst | |||
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop AMR.supergroup --vcf pvt1.recode.vcf --out AFR-AMR --remove-indels | |||
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop EAS.supergroup --vcf pvt1.recode.vcf --out AFR-EAS --remove-indels | |||
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop EUR.supergroup --vcf pvt1.recode.vcf --out AFR-EUR --remove-indels | |||
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out AFR-SAS --remove-indels | |||
vcftools --weir-fst-pop AMR.supergroup --weir-fst-pop EAS.supergroup --vcf pvt1.recode.vcf --out AMR-EAS --remove-indels | |||
vcftools --weir-fst-pop AMR.supergroup --weir-fst-pop EUR.supergroup --vcf pvt1.recode.vcf --out AMR-EUR --remove-indels | |||
vcftools --weir-fst-pop AMR.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out AMR-SAS --remove-indels | |||
vcftools --weir-fst-pop EAS.supergroup --weir-fst-pop EUR.supergroup --vcf pvt1.recode.vcf --out EAS-EUR --remove-indels | |||
vcftools --weir-fst-pop EAS.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out EAS-SAS --remove-indels | |||
vcftools --weir-fst-pop EUR.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out EUR-SAS --remove-indels | |||
# concatenate vcf from different chromosomes | |||
vcf-concat apol1-exon-6-snps.vcf tvp23-exon-1-snps.vcf hpr-exon-5-snps.vcf > 3-exons.vcf | |||
# vcf to tabular format | |||
bcftools query -f '%CHROM\t%POS\t%ID\t%REF\t%ALT[\t%SAMPLE=%GT]\n' 3-exons.vcf > tmp | |||
vcf-query -f '%CHROM\t%POS\t%ID\t%REF\t%ALT[\t%SAMPLE=%GT]\n' 3-exons.vcf > tmp | |||
</syntaxhighlight> | |||
=Ggplot2 tips= | |||
* Data binning and nice histograms with density and boxplot: | |||
[https://www.jdatalab.com/data_science_and_data_mining/2017/01/30/data-binning-plot.html R binning] | |||
<syntaxhighlight lang="bash"> | |||
# numerical vector as factor so that it is sorted numerically (no need for as.character()) | |||
x.df$train.size <- as.factor(x.df$train.size) | |||
# jitter by group with "position_jitterdodge()" | |||
x.df %>% | |||
ggplot(aes(x=rate.cat, y=accuracy, color=group)) + | |||
geom_boxplot(position=position_dodge(0.8)) + | |||
geom_jitter(position=position_jitterdodge(0.8)) + | |||
facet_wrap(~train.size, nrow = 1) + ylim(0,1) + | |||
geom_abline(intercept = 0.5, slope = 0, linetype="dashed") + | |||
theme(legend.position = "bottom") | |||
# line plot with multiple factors with "interaction()" | |||
rec.df %>% | |||
ggplot(aes(x = tissue, y = rec.rate)) + | |||
geom_boxplot(outlier.shape = NA, aes(fill = tissue), alpha = 0.5) + | |||
geom_point(size = 3, alpha = 0.5, aes(color = symptom)) + | |||
geom_line(aes(group = interaction(id, timepoint)), linetype = 2) + | |||
theme_bw() + | |||
scale_fill_manual(values = c("lightgreen", "lightpink")) + | |||
ylab("Num Rec frags") + | |||
xlab("tissue") + | |||
scale_y_log10() | |||
</syntaxhighlight> | |||
=Capture results in R/GA example= | |||
<syntaxhighlight lang="bash"> | |||
# in general use | |||
lapply(seq_along(x), function(i) {name=names(x}[i]) | |||
# to capture names | |||
# save to a data.frame | |||
# bind into a single data.frame using dplyr function: | |||
x.df <-bind_rows(x.rate) | |||
library(stringdist) | |||
library(ggplot2) | |||
out.fit <- lapply(seq(from = 5,to = 150, by = 5), function (num.epi) { | |||
num.alle <- 20; # num of antigens | |||
epi.fit <- function(x) { # fitness defined by the minimum pair diff | |||
x.list <- split(x, rep(1:num.alle, each=num.epi)) | |||
# sum(seq_distmatrix(x.list, method = "hamming"))/(num.alle * (num.alle-1) / 2)/num.epi # average pairwise diff | |||
min(seq_distmatrix(x.list, method = "hamming"))/num.epi # min diff | |||
} | |||
epi.ga <- ga(type = "binary", fitness = epi.fit, nBits = num.epi * num.alle) | |||
c(all = num.alle, epi = num.epi, min.pair.dist = epi.ga@fitnessValue) | |||
}) | |||
epi.df <- t(as.data.frame(out.fit)) | |||
rownames(epi.df) <- 1:nrow(epi.df) | |||
ggplot(as.data.frame(epi.df), aes(x=epi, y=min.pair.dist)) + geom_point() + geom_line() | |||
</syntaxhighlight> | |||
=NCI Cloud (Seven Bridges)= | |||
* Documentation: http://www.cancergenomicscloud.org/controlled-access-data/ | |||
* [https://docs.cancergenomicscloud.org/blog/programmatically-access-tcga-data-using-the-seven-bridges-cancer-genomics-cloud API Documentation (to access meta-data)] | |||
* Steps (June 20, 2018) | |||
** Create project | |||
** Data -> Data Overview -> Select cancer type -> Data Browser | |||
** Copy files to project | |||
** Go to project, "add filter", filter by "experimental strategy" (RNA-SEQ, miRNA-SEQ) | |||
** To download files: select & Download link; run <code>aria2c -i download-links.txt</code> | |||
** To download meta data: Download manifest | |||
* Steps (better) | |||
# Create project | |||
# Search "Public Apps" | |||
# Load data & Run | |||
* Steps (a little hard to follow) | |||
# Create project | |||
# Data -> Data Overview -> Select cancer type -> Data Browser | |||
# Click File to add property (e.g., "miRNA") -> "Copy Files to Project" -> choose project to add & add a tag to the files | |||
# Go to Project -> Files -> filter files by tag name -> select -> Save | |||
# Choose a public protocol/workflow (e.g., RNA-SEQ alignment) | |||
# Add index and GTF files | |||
# Go to Project -> task -> run | |||
=Reloop a circular plasmid from PacBio assembly= | |||
# Input file: Z9-cp26.fa (containing overlapping ends); b31-cp26.fa (reference) | |||
# Find overlap ends by blasting against itself: blastn -task megablast -query Z9-cp26.fa -subject Z9-cp26.fa -evalue 1e-100 -outfmt 6 | |||
# The result says “1 -7617” is the same as “26489-34118”, so we use bioseq to remove overlapping part: bioseq –s”1,26488” Z9-cp26.fa > Z9-cp26.fa2 | |||
# Run numcer against b31-cp26 to identify the starting position: nucmer --coord ../b31-cp26.fa Z9-cp26.fa2 | |||
# The result says the first base of B31 corresponds to 22171 at Z9-cp26, so we run bioseq to reloop: bioseq –R 22171 Z9-cp26.fa2 > Z9-cp26.fa3 | |||
# Run numcer to confirm: nucmer --coord ../b31-cp26.fa Z9-cp26.fa3 | |||
=KEGG REST API= | |||
<syntaxhighlight lang=python"> | |||
# Author: Edgaras Bezrucenkovas | |||
# Date: Nov 12, 2017 | |||
#KEGG API | |||
#Obtain module pathways and orthologs from KEGG pa14 database | |||
#Import module to fetch the data from KEGG database | |||
import urllib.request | |||
import re #Regular expressions | |||
#Get PA14 modules | |||
kegg_db = "http://rest.kegg.jp/link/module/pau" | |||
pa14_mdata = urllib.request.urlopen(kegg_db).read().decode('utf-8').splitlines() | |||
pa14_mods = [] | |||
for line in pa14_mdata: | |||
line = line.split("\t") | |||
mod = line[1].strip("md:pau_") | |||
pa14_mods.append(mod) | |||
#Get PA14 genes | |||
kegg_db = "http://rest.kegg.jp/link/pau/module" | |||
pa14_gdata = urllib.request.urlopen(kegg_db).read().decode('utf-8').splitlines() | |||
pa14_genes = [] | |||
for line in pa14_gdata: | |||
gdata = line.split("\t") | |||
gdata[0] = gdata[0].strip("md:pau_") | |||
gdata[1] = gdata[1].strip("pau:") | |||
pa14_genes.append(gdata) | |||
#Open the file containing KEGG compounds ids | |||
id_file = open("kegg-entries.txt") | |||
kegg_ids = id_file.readlines() | |||
compound_ids = [] | |||
for cid in kegg_ids: | |||
cid = cid.strip("\n") | |||
compound_ids.append(cid) | |||
id_file.close() | |||
#Get module pathway ids | |||
for cid in compound_ids: | |||
kegg_db = "http://rest.kegg.jp/link/module/compound:"+cid | |||
module_data = urllib.request.urlopen(kegg_db).read().decode('utf-8').splitlines() | |||
module_ids = [] | |||
for line in module_data: | |||
if re.match("cpd", line): | |||
line = line.split("\t") | |||
m_id = line[1].strip("md:") | |||
module_ids.append(m_id) | |||
else: | |||
module_ids.append("NA") | |||
#Filter module pathway ids | |||
modules_final = [] | |||
for m_id in module_ids: | |||
if m_id == "NA": | |||
modules_final.append("NA") | |||
elif m_id in pa14_mods: | |||
modules_final.append(m_id) | |||
if not modules_final: | |||
modules_final.append("NA") | |||
#Get genes | |||
genes = {} | |||
for m_id in modules_final: | |||
key = m_id | |||
genes.setdefault(key, []) | |||
if m_id == "NA": | |||
genes[key].append("NA") | |||
else: | |||
for i in pa14_genes: | |||
if m_id == i[0]: | |||
genes[key].append(i[1]) | |||
#Get module names using module ids | |||
module_names = {} | |||
for m_id in modules_final: | |||
if m_id == "NA": | |||
m_name = {"NA":"NA"} | |||
module_names.update(m_name) | |||
else: | |||
kegg_db = "http://rest.kegg.jp/list/module:"+m_id | |||
module_data = urllib.request.urlopen(kegg_db).read().decode("utf-8").split("\t") | |||
module_name = module_data[1].strip("\n") | |||
m = {m_id:module_name} | |||
module_names.update(m) | |||
#Output | |||
for k, v in genes.items(): | |||
for i in v: | |||
print(cid,k,i,module_names.get(k), sep = "\t") | |||
</syntaxhighlight> | |||
=D3js Tutorial= | |||
# Install brackets editor from adobe: http://brackets.io/ | |||
# Enable web server & create a directory "public_html" in your home directory | |||
# Create the following file structure: test/index.html; test/js/index.js; test/css/index.css | |||
# Basic D3: following this link | |||
# Metabolomics: following this link | |||
=Transform a wide data frame to a long one= | |||
* A function in R | |||
<syntaxhighlight lang="bash"> | |||
df2long = function(x, varname, cname, rname){ | |||
num.col = dim(x)[2] | |||
x$tmp = rownames(x) | |||
y = reshape(x, varying=1:num.col, v.names=varname, timevar=cname, times=names(x)[1:num.col], direction="long") | |||
y=y[,-4] | |||
rownames(y)=NULL | |||
colnames(y)[1] = rname | |||
y | |||
} | |||
</syntaxhighlight> | |||
* A function in Perl | |||
<syntaxhighlight lang="perl"> | |||
#!/usr/bin/env perl | |||
# expect a data frame with row and col headings | |||
use strict; | |||
use warnings; | |||
use Data::Dumper; | |||
my $first = 0; | |||
my @colnames; | |||
my %data; | |||
while(<>) { | |||
chomp; | |||
$first++; | |||
if ($first == 1) { | |||
@colnames = split; | |||
next; | |||
} | |||
my @data = split; | |||
my $rowname = shift @data; | |||
for (my $i=0; $i<=$#data; $i++) { | |||
$data{$rowname}->{$colnames[$i]} = $data[$i]; | |||
} | |||
} | |||
#print Dumper(\%data); | |||
foreach my $row (keys %data) { | |||
foreach my $col (@colnames) { | |||
print $row, "\t", $col, "\t", $data{$row}->{$col}, "\n"; | |||
} | |||
} | |||
exit; | |||
</syntaxhighlight> | |||
=Variant call with samtools/bcftools & variant verification using IGV= | |||
# mpileup: <code>samtools mpileup -uf ref.fa sorted1.bam sorted2.bam ... </code> | |||
# [https://samtools.github.io/bcftools/howtos/variant-calling.html call variants]: <code>bcftools call -mv > var.raw.vcf </code> OR: <code>bcftools call -c -v --ploidy 1 gbs-50.mpileup > raw.vcf </code> | |||
# extract only SNP sites: <code>vcftools --vcf input_file.vcf --remove-indels --recode --recode-INFO-all </code> | |||
# filter by quality: <code>bcftools filter -i '%QUAL>200' gbs50-snps.recode.vcf > gbs50-snps2.vcf </code> | |||
# check by TsTv: <code>bcftools stats gbs50-snps2.vcf | grep TSTV </code> | |||
# Extract SNPs into Fasta: | |||
## Or, with bcftools: <code>bcftools query -l gbs50-snps2.vcf > samples</code> | |||
## <code>cat samples | while read line; do echo ">$line"; bcftools query -s "$line" -f '[%TGT]' gbs50-snps2.vcf; echo; done > samples.fas </code> | |||
## get ref seq: <code>echo ">ref" >> sample.fas; grep "^CP" gbs50-snps2.vcf | cut -f4 | paste -s -d '' >> sample.fas</code> | |||
# Visualization with IGB | |||
## Prepare & load reference genomes | |||
## Load FASTA: <code>bioseq -i'genbank' ref.gb > ref.fas</code> | |||
## Prepare GFF3 file: <code>bp_genbank2gff3.pl --CDS --filter exon --filter gene /home/chongdi/michelle/pa_rp73.gb</code> | |||
# Prepare BAM files (see below on how to index and align reads using bwa and samtools, in "ospC Amplicon") | |||
# Index sorted bam files with samtools & load BAM files (multiple bam files okay) | |||
=KRAKEN= | |||
# assigns taxonomic labels to short DNA reads by examining the k-mers within a read and querying a database with those k-mers: <code>kraken -db /belfer-ebox/projects/old_backup/qiulab/minikraken_20141208 --fastq-input 02015P1_S18_L001_R1_001.fastq.gz 02015P1_S18_L001_R2_001.fastq.gz --gzip-compressed --output outfile --paired </code> | |||
# summarize taxonomy: <code> kraken-translate --db /belfer-ebox/projects/old_backup/qiulab/minikraken_20141208 outfile > predict.file </code> | |||
# count unique strains: <code>pat-8]$ cut -f2 s75.predict | cut -f10 -d';' | grep "^[a-zA-Z]" | sort | uniq -c | sort -rn</code>. | |||
# Pick the strain with the highest counts as the reference genome | |||
=PATRIC microbial genome annotation CLI= | |||
* Install Debian distribution from github: https://github.com/PATRIC3/PATRIC-distribution/releases/tag/1.015 | |||
* Tutorial: http://tutorial.theseed.org/PATRIC-Tutorials/ | |||
* Fetch all genomes from a genus: <code>p3-all-genomes --in genome_name,Borrelia > Borrelia.genomes</code>; <code>p3-get-genome-data -i Borrelia.genomes -e genome_status,complete > Borrelia-complete.genomes</code> | |||
* Retrieves features from coding sequences only: input file must be a list of genome ids with a header! <code>p3-get-genome-features -i $file -e feature.feature_type,CDS -a pgfam_id -a patric_id -a plfam_id -a start -a end -a strand -a genome_name -a product -a accession > ${name}-all-features.txt </code> | |||
* Retrieve feature sequence: <code>p3-echo -t feature.accession "fig|100177.4.peg.1" | p3-get-feature-sequence --dna</code> | |||
* Submit genomes for annotation | |||
# Log in: p3-login user name/password | |||
# Submit a genome for annotation: | |||
## <code>submit-patric-annotation --scientific-name "Pseudomonas aeruginosa" --taxonomy-id 287 --genetic-code 11 --domain Bacteria --log pa.log /weigang@patricbrc.org/home/wsdir gid_5.fas</code> | |||
## <code>submit-patric-annotation --scientific-name "Streptococcus agalactiae" --taxonomy-id 1311 --genetic-code 11 --domain Bacteria --log sa-1.log /weigang@patricbrc.org/home/wsdir sa-1.fas</code> | |||
## Message: "Uploading gid_5.fas to workspace at /weigang@patricbrc.org/home/wsdir/gid_5/gid_5.fas” | |||
# Create genome groups | |||
## login | |||
## <code>cat trep.complete.ids | p3-put-genome-group "Treponema complete”</code> | |||
## <code>p3-get-genome-group "Treponema complete”</code> | |||
=Parsimony reconstruction using MPR= | |||
<syntaxhighlight lang=R"> | |||
# MPR for each column | |||
plot.mpr <- function(column=1) { | |||
plot.phylo(tr.unrooted, main = paste(colnames(ph.t)[column])) | |||
tmpr<-MPR(ph.t[,column], tr.unrooted, outgroup = "gid_1311.1320") | |||
nodelabels(paste("[", tmpr[, 1], ",", tmpr[, 2], "]", sep = "")) | |||
tiplabels(ph.t[,column][tr.unrooted$tip.label], adj = -2) | |||
} | |||
# add internal node states | |||
datalist <- data.frame(fam=character(), a=numeric(), b=numeric(), c=numeric()) | |||
for (i in 1:ncol(ph.t)) { | |||
#for (i in 1:10) { | |||
tmpr<-MPR(ph.t[,i], tr.unrooted, outgroup = "gid_1311.1320"); | |||
out<-c(colnames(ph.t)[i],tmpr[,1]) | |||
datalist <- rbind(datalist, data.frame(fam=colnames(ph.t)[i], a=tmpr[1,1], b=tmpr[2,1], c=tmpr[3,1])) | |||
} | |||
#plotting gains and losses | |||
tr.unrooted <- unroot(tr) | |||
gains<-apply(ph.node.states[,9:15], 2, function(x) length(which(x>0))) | |||
losses<-apply(ph.node.states[,9:15], 2, function(x) length(which(x<0))) | |||
plot(tr.unrooted) | |||
edgelabels(gains, adj = c(0.5,-0.25), col=2, frame= "none") | |||
edgelabels(losses, adj = c(0.5,1.25), col=4, frame= "none") | |||
</syntaxhighlight> | |||
=Amplicon NGS sequencing= | |||
==Nanopore reads of ospC amplicons from ticks (Fall 2025)== | |||
<syntaxhighlight lang="bash"> | |||
# To index onto a reference fasta: | |||
minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa | |||
# This was for initial mapping, generated .sam files that were named "barcode#.f#.sam" | |||
# needed them numbered because there were hourly fastq files for this data | |||
i=0; | |||
for file in *.gz; do | |||
i=$((i+1)); | |||
barcode_num=$(echo "$file" | sed -E 's/.*barcode([0-9]{2}).*/\1/'); | |||
output_name="barcode${barcode_num}.f$(printf "%02d" $i).sam"; | |||
echo "Processing $file -> $output_name"; | |||
minimap2 -ax map-ont /scratch/weigang/ospC-ref-nuc.fas "$file" > "$output_name"; | |||
done | |||
# convert to binary file & sort reads | |||
samtools view –b sample.sam > sample.bam | |||
samtools sort sample.bam sample.sorted.bam | |||
# can do this for all sam tools, just need to make sure you change the *.sam in the beginning, the output_name= in the beginning, and then it should work | |||
for f in *.sam; do | |||
output_name="${f%.sam}.bam"; | |||
echo "Converting $f to $output_name"; | |||
samtools view -b "$f" > "$output_name"; | |||
done | |||
#need to change the .bed location if using a different .bed file | |||
for p in $(ls *sorted.bam | sed 's/\.f[0-9]\{2\}\.sorted\.bam//' | sort -u); do | |||
echo "Processing $p..."; | |||
for f in "$p".f*.sorted.bam; | |||
do | |||
bedtools coverage -abam "$f" -b /scratch/weigang/ospC.bed -d | cut -f1,4,5 | grep -v -w "0$" | while read line; do echo -e "$p\t$line"; | |||
done; | |||
done > "$p".cov; | |||
done | |||
</syntaxhighlight> | |||
==Illumina reads (2022)== | |||
<syntaxhighlight lang="bash"> | |||
#Index nucleotide file: | |||
bwa index ref.fa | |||
#align: | |||
bwa mem ref.fa sample_read1.fq sample_read2.fq > sample.sam | |||
#BAM output: | |||
samtools view -b sample.sam > sample.bam | |||
#Sort & index BAM file: | |||
samtools sort -o sample.sorted sample.bam | |||
samtools index sample.sorted | |||
# Calculate coverage by bedtools (better, raw read coverages) | |||
Based on the update: https://bioinformatics.stackexchange.com/questions/2318/how-to-count-reads-in-bam-per-bed-interval-with-bedtools | |||
bedtools bamtobed -i sample.sorted > sample.bed # bam to bed | |||
bedtools coverage -b sample.bed -a ospC.bed > sample.coverage | |||
Alternatives (not good): | |||
bedtools coverage -b sample.sorted.bam -a refs.bed -d > sample.bedtools.cov # per-site | |||
bedtools coverage -b sample.sorted.bam -a refs.bed -counts > sample.bedtools.cov # average | |||
# Generate VCF file (not needed for coverage) | |||
samtools mpileup -uf ref.fa s18.sorted.bam s56.sorted.bam > test.mpileup | |||
bcftools call -c -v test.mpileup > test.raw.vcf | |||
#R plot | |||
</syntaxhighlight> | |||
<syntaxhighlight lang="bash"> | |||
# BASH script from Tony Fung & Jamie Cabigas (Spring 2019) | |||
#!/usr/bin/env bash | |||
# ---------------------------------------- | |||
# File : fas-to-vcf.sh | |||
# Author : Tony Fung & Jamie Cabigas | |||
# Date : March 21, 2019 | |||
# Description : Batch convert FAS files to VCF files | |||
# Requirements : samtools 1.9, bcftools 1.9, bwa 0.7.12 | |||
# Input : reference file, format of sequence files, up to 7 sequence id's | |||
# Sample Command : bash fas-to-vcf.sh ref.fasta fastq ERR221622 ERR221661 ERR221662 ERR221663 | |||
# Output : up to 7 VCF files | |||
# ---------------------------------------- | |||
if [ $# -lt 3 ] | |||
then | |||
echo "Usage: bash $0 <ref_file> <format_of_sequence_files> <sequence_id> [<sequence_id_2> <sequence_id_3> etc.]"; | |||
exit; | |||
fi | |||
for arg | |||
do | |||
if [ $arg == $1 ] | |||
then | |||
ref_file="../$1"; | |||
elif [ $arg == $2 ] | |||
then | |||
file_format=$2; | |||
else | |||
seq_id=$arg; | |||
fas_file_1="${seq_id}_1.$file_format"; | |||
fas_file_2="${seq_id}_2.$file_format"; | |||
pwd; | |||
cd $seq_id; | |||
pwd; | |||
# Index nucleotide file: | |||
bwa index $ref_file; | |||
# Align: | |||
bwa mem $ref_file $fas_file_1 $fas_file_2 > $seq_id.sam | |||
# BAM output: | |||
samtools view -b $seq_id.sam > $seq_id.bam | |||
# Sort & index BAM file: | |||
samtools sort $seq_id.bam -o $seq_id.sorted.bam | |||
samtools index $seq_id.sorted.bam | |||
# Generate VCF file: | |||
# -u is deprecated, use bcftools mpileup instead | |||
# samtools mpileup -uf $ref_file $seq_id.sorted.bam > $seq_id.mpileup | |||
bcftools mpileup -f $ref_file $seq_id.sorted.bam > $seq_id.mpileup | |||
bcftools call -c -v $seq_id.mpileup > $seq_id.raw.vcf | |||
cd ..; | |||
pwd; | |||
fi | |||
done | |||
</syntaxhighlight> | |||
=Running a Screen Session= | |||
==use byobu== | |||
# start a screen session by typing "byobu" | |||
# run commands | |||
# Detach by pressing "F6" | |||
# Reattach by typing "byobu" | |||
# Terminate by typing "exit" | |||
==use screen== | |||
* Start a screen session | |||
<div class="toccolours mw-collapsible"> | |||
<syntaxhighlight lang=bash"> | |||
screen | |||
</syntaxhighlight> | |||
</div> | |||
* Detach the running mission | |||
<div class="toccolours mw-collapsible"> | |||
<syntaxhighlight lang=bash"> | |||
ctrl + A + D | |||
</syntaxhighlight> | |||
</div> | |||
* Show the list of running process | |||
<div class="toccolours mw-collapsible"> | |||
<syntaxhighlight lang=bash"> | |||
screen -ls | |||
</syntaxhighlight> | |||
</div> | |||
* Reattach a running process | |||
<div class="toccolours mw-collapsible"> | |||
<syntaxhighlight lang=bash"> | |||
screen -r ProcessID | |||
</syntaxhighlight> | |||
</div> | |||
* Terminate a process | |||
<div class="toccolours mw-collapsible"> | |||
<syntaxhighlight lang=bash"> | |||
ctrl + A | |||
:quit | |||
</syntaxhighlight> | |||
</div> | |||
=Bp-utils: sequence, alignment & tree utilities by Qiu Lab= | =Bp-utils: sequence, alignment & tree utilities by Qiu Lab= | ||
==bioseq: sequence/FASTA manipulations== | ==bioseq: sequence/FASTA manipulations== | ||
| Line 137: | Line 1,230: | ||
==BLAST+: search("google") for homologs/pariwise alignment== | ==BLAST+: search("google") for homologs/pariwise alignment== | ||
==hmmer== | ==hmmer== | ||
* link: http://hmmer.org/ | |||
* Installation: <code>% conda install -c biocore hmmer </code> # Anaconda | |||
* Build profile: <code>hmmbuild globins4.hmm globins4.sto</code> | |||
* Search: <code>hmmsearch globins4.hmm uniprot_sprot.fasta > globins4.out</code> | |||
==cdhit== | ==cdhit== | ||
<syntaxhighlight lang="bash"> | <syntaxhighlight lang="bash"> | ||
| Line 155: | Line 1,253: | ||
=Programs for producing multiple alignments= | =Programs for producing multiple alignments= | ||
==MUSCLE== | ==MUSCLE== | ||
==MUGSY== | |||
* MUGSY bash | |||
<syntaxhighlight lang="bash"> | |||
#!/bin/sh | |||
export MUGSY_INSTALL=/home/weigang/mugsy_x86-64-v1r2.2 | |||
export PATH=$PATH:$MUGSY_INSTALL:$MUGSY_INSTALL/mapping | |||
export PERL5LIB=$MUGSY_INSTALL/perllibs | |||
#For testing TBA | |||
#export PATH=$PATH:$MUGSY_INSTALL/../../multiz-tba/trunk/ | |||
</syntaxhighlight> | |||
* source the bash file | |||
<syntaxhighlight lang="bash"> | |||
source mugsyenv.sh | |||
</syntaxhighlight> | |||
*run mugsy | |||
<syntaxhighlight lang="bash"> | |||
mugsy --directory /home/chongdi/Streptococcus/mugsy-output -prefix mugsy_aln mugsy-input/*.fa | |||
</syntaxhighlight> | |||
==CLUSTALW== | ==CLUSTALW== | ||
==MAFT== | ==MAFT== | ||
| Line 160: | Line 1,280: | ||
=Programs for producing phylogeny & phylogenetic analysis= | =Programs for producing phylogeny & phylogenetic analysis= | ||
==IQ-Tree== | |||
* [http://www.iqtree.org/doc/Tutorial Beginner's tutorial] | |||
* [http://www.iqtree.org/doc/Advanced-Tutorial Advanced tutorial] | |||
* Model search (slow!! better done with byobu) | |||
** <code>iqtree -s example.phy -m MFP</code> | |||
* protein tree with fast bootstrap: | |||
** <code>iqtree -s example.phy -m WAG+I+G -bb 1000</code> (version 1.xx; -B for latest version) | |||
* site-specific rates: | |||
** <code>iqtree -s example.phy -rate</code> | |||
** <code>iqtree -s example.phy -wsr</code> (version 1.xx; -t and -m from above to save time) | |||
* ancestral state reconstruction: | |||
** <code>iqtree -s example.phy -asr</code> (-t and -m from above to save time) | |||
==FastTree== | ==FastTree== | ||
==PHYLIP== | ==PHYLIP== | ||
==MrBayes== | ==MrBayes== | ||
==RaXML== | ==RaXML== | ||
* Required arguments | |||
** -s alignment (in PHYLIP or FASTA) | |||
** -n tag | |||
* Simple run (ML): <code>raxmlHPC-SSE3 -x 12345 -p 12345 -# autoMRE -s concat.fas -m GTRGAMMA -n tag -q part.txt</code> | |||
* Bootstrap: <code>raxmlHPC-SSE3 -f a -x 12345 -p 12345 -# 100 -s concat.fas -m GTRCAT -n tag -q part.txt</code> | |||
* Make a file named "part.txt" with the following lines (Chanlge the number to the total length of your alignment): | |||
<pre> | |||
DNA, gene1codon1 = 1-3765906\3 | |||
DNA, gene1codon2 = 2-3765906\3 | |||
DNA, gene1codon3 = 3-3765906\3 | |||
</pre> | |||
* The resulting files | |||
** RAxML_bestTree.tag: best tree (no bootstrap) | |||
** RAxML_bipartitionsBranchLabels.tag: ignore | |||
** RAxML_bipartitions.tag: main result. Feed this tree to figtree | |||
** RAxML_bootstrap.tag: ignore | |||
** RAxML_info.tag : log file | |||
* Protein models | |||
** <code>raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAS</code> # protein, gamma, Whelan & Goldman (2001) model | |||
** <code>raxmlHPC-SSE3 -s protein.phy -n A2 -m PROTGAMMAGTR</code> # protein, gamma, user model | |||
** <code>raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAG -# 100 -p 0123 </code> # protein, gamma, Whelan & Goldman (2001) model, bootstrap | |||
** <code>raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAG -o Carp,Loach</code> # protein, gamma, Whelan & Goldman (2001) model, root on a (monophyletic group) | |||
** <code>raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAS -# autoFC -p 0123 </code> # protein, gamma, Whelan & Goldman (2001) model, bootstrap (at least 99 splits, auto-stopping) | |||
** <code>raxmlHPC-SSE3 -f a -s protein.phy -n A1 -m PROTGAMMAWAG -# 100 -p 0123 -x 0123 </code> # Rapid bootstrap with consensus | |||
*** output 1, RAXML_bestTree.A1 (ml tree) | |||
*** output 2, RAXMLbootstrap.A1 (bootstrap relicates) | |||
*** output 3, RAXMLbipartitions.A1 (tree with boot strap values) | |||
==PhyloNet== | ==PhyloNet== | ||
=R packages for phylogenetics= | =R packages for phylogenetics= | ||
==APE== | ==APE== | ||
===Convert a tree to ultrametric using time estimates=== | |||
<code> | |||
t <- read.tree("core-tree-30otus.dnd") | |||
t.ultra <- chronopl(t, 0) | |||
t.hclust <- as.hclust(t.ultra) | |||
t.dendro <- as.dendrogram(t.hclust) | |||
heatmap(ge.var, Rowv=t.dendro) # order the rows with customized tree | |||
</code> | |||
==phengorn== | ==phengorn== | ||
==phytools== | ==phytools== | ||
=Population genetics= | =Population genetics= | ||
==LDHat: test of recombination based on 4-gametes== | |||
* filter sites: <code>convert -seq snps.sites -loc snps.locs -freqcut 0.08 </code> | |||
* Pairwise LD tests: First generate "lookup" table: <code>lkgen -lk /usr/local/LDhat/lk_files/lk_n50_t0.001 -nseq 48</code>; then calculate pairwise LD statistics: <code>pairwise -seq sites.txt -loc locs.txt -lk new_lk.txt</code> | |||
* Run interval for recombination hot spots: <code>interval -seq sites.txt -loc locs.txt -lk new_lk.txt -its 1000000 -bgen 5 -exact</code> | |||
* Get stats: <code> stat -input rates.txt -loc locs.txt -burn 50 (burnin=100K)</code> | |||
* Plot in R: | |||
<syntaxhighlight lang = "bash"> | |||
x = read.table("rates.txt", skip=1, fill=T); | |||
x = as.matrix(x); | |||
burn.in = 50; | |||
low = as.integer(nrow(x)*burn.in/100); | |||
means<-apply(x[low:nrow(x),], 2, mean, na.rm=T); | |||
q.95<-apply(x[low:nrow(x),], 2, quantile, probs=c(0.025, 0.5, 0.975), na.rm=T); | |||
pos<-as.vector(as.matrix(read.table("locs.txt", as.is=T, skip=1))); | |||
plot(pos[1:(length(pos)-1)], y=means[2:length(means)], type="s", col=rgb(0,0,0.5), | |||
xlab="SNP position (B111)", ylab="Posterior mean recombination rate", main="GBS Strep: recombination by LDhat"); | |||
lines(pos[1:(length(pos)-1)], y=q.95[1,2:length(means)], type="s", col=grey(0.75), lty="dotted"); | |||
lines(pos[1:(length(pos)-1)], y=q.95[3,2:length(means)], type="s", col=grey(0.75), lty="dotted"); | |||
</syntaxhighlight> | |||
==ms: coalescence simulation== | ==ms: coalescence simulation== | ||
==SFS: forward simulation== | ==SFS: forward simulation== | ||
| Line 278: | Line 1,472: | ||
script, File1, File2 = argv | script, File1, File2 = argv | ||
# Create a dictionary listing the sequences in the first file for reference | |||
file1 = open(File1) | file1 = open(File1) | ||
dict1 = {} | dict1 = {} | ||
| Line 289: | Line 1,484: | ||
file1.close() | file1.close() | ||
# Create two output files | |||
f1 = open(File1.replace('.fastq', '_mat.fq'), 'w') | f1 = open(File1.replace('.fastq', '_mat.fq'), 'w') | ||
f2 = open(File2.replace('.fastq', '_mat.fq'), 'w') | f2 = open(File2.replace('.fastq', '_mat.fq'), 'w') | ||
# Match the sequence | |||
file2 = open(File2) | file2 = open(File2) | ||
for line in file2: | for line in file2: | ||
if dict1.has_key(line.rstrip()[:-9]): | if dict1.has_key(line.rstrip()[:-9]): # The has_key method | ||
tag1 = line.rstrip()[:-9] | tag1 = line.rstrip()[:-9] | ||
f1.write(tag1 + tail + '\n') | f1.write(tag1 + tail + '\n') | ||
| Line 300: | Line 1,497: | ||
f1.write(dict1[tag1][j] + '\n') | f1.write(dict1[tag1][j] + '\n') | ||
del dict1[tag1] | del dict1[tag1] | ||
dict2 = {} | dict2 = {} # Create a temporary dictionary for sequence in the file2 | ||
tag2 = line.rstrip() | tag2 = line.rstrip() | ||
dict2[tag2] = [] | dict2[tag2] = [] | ||
| Line 315: | Line 1,512: | ||
</syntaxhighlight> | </syntaxhighlight> | ||
==Step 2. | ==Step 2. Clean Fastq Files & Run Single-color Graph & Error Cleaning== | ||
* Create a file list showing all outcome files whose extensions need to be changed from _mat.fq to .list | |||
<syntaxhighlight lang="bash"> | |||
bbduk.sh -Xmx1g in1=fastq_file1 in2=fastq_file2 -out1=clean1.fq -out2=clean2.fq qtrim=rl trimq=20 | |||
</syntaxhighlight> | |||
* Create a file list showing all outcome files whose extensions need to be changed from _mat.fq to .list | * Create a file list showing all outcome files whose extensions need to be changed from _mat.fq to .list | ||
<syntaxhighlight lang="bash"> | <syntaxhighlight lang="bash"> | ||
| Line 340: | Line 1,541: | ||
<syntaxhighlight lang="bash"> | <syntaxhighlight lang="bash"> | ||
../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1 | ../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1 | ||
--se_list ref.filelist | --se_list ref.filelist | ||
--kmer_size 31 | --kmer_size 31 | ||
--mem_height 17 | --mem_height 17 | ||
--mem_width 100 | --mem_width 100 | ||
--dump_binary ref.ctx | --dump_binary ref.ctx | ||
--sample_id ref | --sample_id ref 20 > ref.log | ||
</syntaxhighlight> | </syntaxhighlight> | ||
* Error | * Run Error Cleaning for All Samples (reference is not included) | ||
<syntaxhighlight lang="bash"> | <syntaxhighlight lang="bash"> | ||
../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1 | ../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1 | ||
--mem_height 18 | --mem_height 18 | ||
--mem_width | --mem_width 100 | ||
--kmer_size 31 | --kmer_size 31 | ||
--multicolour_bin | --multicolour_bin N18_S15.ctx | ||
--remove_low_coverage_supernodes 10 | --remove_low_coverage_supernodes 10 | ||
--dump_binary | --dump_binary N18_S15.cleaned.ctx | ||
</syntaxhighlight> | </syntaxhighlight> | ||
==Step | ==Step 3== | ||
* | * Pull the name of each .cleaned.ctx file to a cleaned.list file, then create a .filelist file for all cleaned.list files. | ||
<syntaxhighlight lang="bash"> | <syntaxhighlight lang="bash"> | ||
ls file1.cleaned.ctx > file1.cleaned.list | |||
ls file2.cleaned.ctx > file2.cleaned.list | |||
ls | |||
ls | |||
ls ref.ctx > ref.list | ls ref.ctx > ref.list | ||
ls -1 *.list > ref-sample.filelist | ls -1 *.list > ref-sample.filelist | ||
| Line 388: | Line 1,577: | ||
</syntaxhighlight> | </syntaxhighlight> | ||
==Step | ==Step 4== | ||
* Variation Discovery Using The Bubble Caller | * Variation Discovery Using The Bubble Caller | ||
<syntaxhighlight lang="bash"> | <syntaxhighlight lang="bash"> | ||
| Line 404: | Line 1,593: | ||
</syntaxhighlight> | </syntaxhighlight> | ||
==Step | ==Step 5== | ||
* Reference Genome | * Reference Genome | ||
(When in Cluster execute "module load stampy": doesn't work; path problem) | |||
(Run the following on wallace:) | |||
<syntaxhighlight lang="bash"> | <syntaxhighlight lang="bash"> | ||
stampy.py -G ref ref.fa | |||
stampy.py -G | stampy.py -g ref -H ref | ||
stampy.py -g | |||
</syntaxhighlight> | </syntaxhighlight> | ||
* Turn Into VCF | * Turn Into VCF with reference | ||
Make a sample list file (from bubble or multicolor log file): | |||
<code>cat e1-bubbles-in-sample.log | grep CLEANED | cut -f2 > e1.sample.lis</code> | |||
Customize the following command based on your output files, num of colors, index of ref colors, etc | |||
<code> | |||
perl /home/weigang/CORTEX_release_v1.0.5.21/scripts/analyse_variants/process_calls-wq.pl --callfile e1-bubbles-in-sample.out --callfile_log e1-bubbles-in-sample.log -outvcf e1-bubbles-in-sample --outdir e1-vcfout --samplename_list e1.sample.list --num_cols 7 --stampy_bin /home/weigang/stampy-1.0.28/stampy.py --stampy_hash ref --refcol 6 --vcftools_dir /usr/local/bin --caller BC --kmer 31 --ploidy 1 | |||
</code> | |||
==Step 6. Parse VCF files== | |||
# Filter out low-quality sites: | |||
<code>vcftools --vcf pat-5.decomp.vcf --keep-filtered PASS --recode --out pat-5</code> | |||
# Extract coverage | |||
<code>vcftools --vcf pat-5.recode.vcf --extract-FORMAT-info COV </code> | |||
(output file: out.COV.FORMAT) | |||
# Extract genotypes | |||
<code>vcftools --vcf pat-5.recode.vcf --extract-FORMAT-info GT </code> | |||
(output file: out.GT.FORMAT) | |||
# Extract confidence | |||
<code>vcftools --vcf pat-5.recode.vcf --extract-FORMAT-info GT_CONF</code> | |||
(output file: out.GT_CONF.FORMAT) | |||
# Send GT_CONF file to R and visualize log10(conf) distribution with boxplot | |||
# Use custom PERL file to filter out low-quality (e.g., GT_CONF < 30) genotype calls (flag with "?" or "na"), and make haplotype GT ("1/1" to "1", "0/0" to "0", "./." to "?) | |||
# Verify variants using IGV (see IGV protocol above) | |||
==Step 7. Variant Annotation & Visualization== | |||
# <code>vcf_parser.py out.decomp.vcf ref.gb</code> (the code needs validation) | |||
# Data to database & web visualization, if necessary | |||
=hmmer= | |||
==Annotate proteins with TIGRFAM== | |||
<syntaxhighlight lang="bash"> | <syntaxhighlight lang="bash"> | ||
hmmsearch --tblout foo.hmmout # table output for all sequences | |||
-- | --domtblout foo.dmout # table output for all domains | ||
- | -E 0.01 # level of sequence significance | ||
-- | --domE 0.01 # level of domain significance | ||
- | -o /dev/null # don't show STDOUT | ||
-- | ../../TIGRFAMs-Release-15-Sep-17-2014/TIGRFAMs_15.0_HMM.LIB # HMM profile library for tiger fams | ||
-- | GCA_000583715.2_ASM58371v2_protein.faa & # input/query file in FASTA | ||
</syntaxhighlight> | </syntaxhighlight> | ||
=PopGenome= | |||
<syntaxhighlight lang=R"> | |||
library(PopGenome) | |||
g = readVCF("pvt1.recode.vcf.gz", 1000, "8", 127890000, 128102000) | |||
pops = split(sample[,1], sample[,2]) # create a list of populations | |||
g = set.populations(g, pops, diploid = T) # set population names | |||
# by windows | |||
slide = sliding.window.transform(g, width = 100, jump = 20) # nsnps, not actual length | |||
slide = F_ST.stats(slide, mode = "nucleotide") | |||
snp.pos = slide@region.data@biallelic.sites # SNP positions | |||
win.num = length(slide@region.names) | |||
win.start = numeric() | |||
for (i in 1:win.num) {win.start[i] = snp.pos[[i]][1]} | |||
fst = slide@nuc.F_ST.vs.all | |||
pop.names = names(slide@populations) # population names | |||
plot(win.start, fst[,1], type ="n", las = 1, ylab = expression(F[st]), xlab = "SNP Position", ylim = c(0,0.4)) | |||
for (i in 1:length(slide@populations)) { | |||
lines(win.start, fst[,i], type = "l", col = pop.group[pop.names[i],4]) | |||
} | |||
arch.coords=c(127982050, 127992931) | |||
abline(v = arch.coords, col = "orange") | |||
#rect(xleft = arch.coords[1], ybottom = -1, xright = arch.coords[2], ytop = 0.5, border = "transparent", col = 2) | |||
</syntaxhighlight> | |||
=Velvet= | |||
==Cleaning== | |||
<syntaxhighlight lang="bash"> | |||
../../bbmap/bbduk.sh -Xmx1g | |||
in1=WGC067462_hunhewenku_509_combined_R1.fastq # gz file works as well | |||
in2=WGC067462_hunhewenku_509_combined_R2.fastq # gz file works as well | |||
-out1=clean1.fq | |||
-out2=clean2.fq | |||
qtrim=rl | |||
trimq=20 | |||
</syntaxhighlight> | |||
==Running Velvet Optimizer== | |||
<syntaxhighlight lang="bash"> | |||
srun ../../VelvetOptimiser-2.2.5/VelvetOptimiser.pl | |||
--t 32 | |||
--s 31 --e 31 --x 6 # kmer sizes | |||
-f '-shortPaired -fastq clean1.fq -shortPaired2 -fastq clean2.fq' | |||
-t 4 | |||
--optFuncKmer ‘n50’ | |||
-p prefix | |||
</syntaxhighlight> | |||
=PacBio assembly with canu= | |||
<code>./canu -p staph-auto-5 -d staph-auto-5 genomeSize=2.2m -pacbio-raw pac-reads-5.tar.gz</code> | |||
Latest revision as of 04:13, 16 November 2025
Exploratory sequence analysis in R (seqinr package)
- Help page: https://cran.r-project.org/web/packages/seqinr/refman/seqinr.html
- Gene family databases: https://doua.prabi.fr/main/index
- Tutorial:
- Hogenom: bacterial (13 phylum) homolog databases: http://hogenom.univ-lyon1.fr/
Genome viewer
- geneviewer is an R package https://wiki.genometracker.org/index.php?title=Mini-Tutorals&action=edit§ion=1for plotting gene clusters and transcripts. It imports data from GenBank, FASTA, and GFF files, perform...
- Ref: https://nvelden.github.io/geneviewer/articles/geneviewer.html
library(geneviewer)
gbk <- read_gbk("cp26.gbf", features = "CDS")
cds_df <- gbk_features_to_df(
gbk,
feature = "CDS",
keys = c("locus_tag", "region", "gene", "protein_id", "gene_kind", "product"),
process_region = TRUE
)
gc.plot <- GC_chart(cds_df, cluster = "cluster", group = "gene", width = "1000px", height = "200px") %>%
GC_labels() |>
GC_scaleBar(title = "1 kb", scaleBarUnit = 1000, y=30) %>%
GC_legend(group = "product")
# Save plot to temp.html file
htmlwidgets::saveWidget(gc.plot, "temp.html", selfcontained = TRUE)
# Save plot to .png (or .jpg, .jpeg, .webp, .pdf)
webshot2::webshot(
"temp.html",
"cp26-gbk.pdf",
vwidth = 1500,
vheight = 300,
zoom = 1, # Increase zoom for higher resolution
selector = ".geneviewer")
Weblogo
- install weblogo from github
- Or install with conda:
conda install -c conda-forge weblogo - Or install with pip:
pip install weblogo - run the following command
weblogo -f IR4-pep.fas -o ir4-logo.pdf -D fasta -F pdf -A protein -s large -t "IR4" -c chemistry
Tree visual with ggtree
- Ref book: https://yulab-smu.top/treedata-book/
setwd("C:/Users/Weigang/Dropbox/Natasha-files/")
library(ggtree)
library(treeio)
library(tidyverse)
# read tree
tree <- read.tree("asian_clade3_v2.nwk")
# create a tibble of OTU groups
tips <- tibble(id = tree$tip.label,
origin = c(rep("Eurasia",4), "US", "Eurasia",
"US", rep("Eurasia",25)))
# plot tree
p <- ggtree(tree) +
xlim(0,0.02) + # to avoid overflow of labels
geom_treescale(x=0, y=30)
# join tree and add group color
p %<+% tips +
geom_tiplab(aes(color = origin)) +
scale_color_manual(values = c("Eurasia" = 1, "US" = 2)) +
theme(legend.position = "none")
Github for sharing data and source code
- SSH setup (github no longer allows password-based push to remote repository)
- Create a new SSH key on your computer
- Add the key to your Github account
- Commit with SSH
- Authentication/test:
ssh -T git@github.com - Add repository for commit:
git remote set-url origin git@github.com:bioperl/p5-bpwrapper.git
- Authentication/test:
- Developer workflow
- Clone remote repository:
git clone <rep-name.git> - Sync local to remote repository:
git pull - Check local repository status:
git status - Show the latest commit:
git log - Add new file:
git add <filename> - Commit changes to local repository:
git commit -a -m "message" - Push to remote repository:
git push
- Clone remote repository:
bcftools pipeline
bcftools view -m2 -M2 --types snps calls.bcf > snps.bcf vcftools --vcf snps4.vcf --maf 0.01 --recode --recode-INFO-all --out maf (n=33 SNPs) bcftools query -l maf.recode.vcf > samples (n=17775 samples) cat samples | while read line; do echo ">$line"; bcftools query -s "$line" -f '[%TGT]' maf.recode.vcf; echo; done > samples-maf.fas
R tips
Phylogeny with data
- Phylosignal (an alternative to ggtree): https://cran.r-project.org/web/packages/phylosignal/vignettes/Demo_plots.html
R one-liners with -e 'EXPR'
# capture numbers in the "tmp" file and then run R:
R -e 'mean(scan(file = "tmp")); q()'
Add binomial test with mutate
get_conf <- function(cts, sum){
dat <- tibble(cts)
names(dat) <- c('cts')
out <- lapply(1:nrow(dat), function(y){
t <- binom.test(dat$cts[y], sum);
lo <- t$conf.int[1];
hi <- t$conf.int[2];
return(c(lo, hi))}
)
return(out)
}
df.hill.fix <- df.hill.fix |> mutate(fix.prob = fix.cts/50,
conf.lo = sapply(get_conf(fix.cts, 50), \(x) x[1]),
conf.hi = sapply(get_conf(fix.cts, 50), \(x) x[2])
)
df.hill.fix <- df.hill.fix |>
mutate(rec.rate = case_when(
c == 0 ~ 'Nc = 0',
c == 1/800 ~ "Nc = 1/4",
c == 1/200 ~ "Nc = 1",
c == 1/50 ~ "Nc = 4",
))
df.hill.fix |>
ggplot(aes(x = s+0.01, y = fix.prob, color = rec.rate )) +
geom_point() +
geom_line(linetype = 1) +
scale_x_log10() +
xlab("sel coef at B/b locus") +
ylab("fixation prob of A allele") +
geom_errorbar(aes(ymin = conf.lo, ymax = conf.hi), width = 0.05) +
theme_bw()
Add expected normal curvce to histogram
plot.trait <- function(qt.out) {
phe <- qt.out[[4]]$phe
exp.mean <- qt.out[['trait.exp']][1]
exp.sd <- sqrt(qt.out[['trait.exp']][2])
x <- seq(min(phe), max(phe), length = 100)
fun <- dnorm(x, mean = exp.mean, sd = exp.sd)
hist(phe, probability = T, ylim = c(0, max(fun)), br = 50, las = 1)
lines(x, fun, col = 2, lwd = 2)
}
Run batch contingency table tests
- Numbered list item
snp_ct <- snp_long %>% group_by(POS, geno, virulence) %>% count()
# get pos with < 4 entries:
bad_pos <- snp_ct %>% group_by(POS) %>% count() %>% filter(n < 4)
library(broom)
# batch fisher's exact test
snp_fisher <- snp_long %>%
filter(!POS %in% bad_pos$POS) %>%
group_by(POS) %>%
do(tidy(xtabs(~geno + virulence, data = .) %>%
fisher.test(simulate.p.value = T)))
snp_fisher <- snp_fisher %>% mutate(y = -log10(p.value))
# plot vocano
snp_fisher %>%
ggplot(aes(x = estimate, y = y)) +
geom_point(shape = 1, alpha = 0.5) +
scale_x_log10() +
geom_vline(xintercept = 1, linetype = 2, color = "red") +
theme_bw() +
xlab("odds ratio (log10)") +
ylab("signficance (-log10[p])")
multiple regression models (with broom::tidy)
library(broom)
compensation.models <- compensation %>% group_by(Grazing) %>% do(tidy(lm(Fruit ~ Root, data = .))) %>% filter(term != '(Intercept)')
multiple regression models (with nested tibble)
# returns a list of models:
mods <- test |>
group_by(gene_id) |>
nest() |>
mutate(model = lapply(data, \(df) lm(log.cts ~ genotype * treat, data = df)))
est.ia <- predict(df.mod$models[[1]], newdata = data.frame(mean.val = c(df.boot.mean |> filter(stat == 'Ia') |> pull(mean.val))), se.fit = T)
exp(est.ia$fit)
exp(est.ia$se.fit)
# get p vals
pvals <- lapply(mods$model, \(x) {
pout <- anova(x)$`Pr(>F)`
return(list(p.geno = pout[1], p.treat = pout[2], p.int = pout[3]))
})
df.pval <- bind_rows(pvals)
# build multiple models, one for each serum:
by_serum <- two_od %>% group_by(Serum) %>% nest() # nested data frame, one row per serum
x_model <- function(df) { # model function (similar to lapply)
x <- df %>% filter(OspC!='A02' & OspC!='A04')
# x <- df %>% filter(OspC!='A02' & OspC!='A04' & OspC!='N14')
lm(OD1 ~ OD2, data = x)
}
by_serum <- by_serum %>% mutate(model = map(data, x_model)) # add model to each serum
output <- vector("list")
for(i in 1:length(by_serum$Serum)) {
df <- by_serum$data[[i]]
model <- by_serum$model[[i]]
pd <- predict.lm(model, newdata = data.frame(OD2 = df$OD2))
output[[i]] <- data.frame(OspC = df$OspC,
OD2 = df$OD2,
OD1 = df$OD1,
OD1_pred = pd,
Serum = rep(by_serum$Serum[i], nrow(df))
)
}
df.out <- bind_rows(output)
multiple regression models (with custum functions)
# build model
models <- xy %>% split(.$Serum) %>% map(~lm( aff_PL ~ aff_C3H, data= .))
# get r-squared:
models %>% map(summary) %>% map_dbl("adj.r.squared")
# get p values (of slope, using a custom function):
get.pvalue <- function(x){
s <- summary(x);
s$coefficients[2, 4]
}
models %>% map(get.pvalue) %>% unlist()
# get slope:
get.slope <- function(x){
s <- summary(x);
s$coefficients[2, 1]
}
models %>% map(get.slope) %>% unlist()
# get intercept:
get.intercept <- function(x){
s <- summary(x);
s$coefficients[1, 1]
}
models %>% map(get.intercept) %>% unlist()
Microbial genome alignment with MUMMER4 and other tools
SARS-CoV-2 GISAID pipleline
#######################################
# Parse GISAID sequences fasta
######################################
1. bioseq -B cov.fas # burst into individual files
1a. move the un-bursted file out the "human-files" directory!!!
mv cov-human.fas ../
2. sam align (weigang@wallace:~/cov-03-09-2030/host-human$ for f in *.fas; do ../sam-align.bash $f; done )
nucmer --sam-long=COH1 B111.fa COH1.fa
samtools view -b COH1.sam -T B111.fa > COH1.bam
samtools sort COH1.bam -o COH1.sorted.bam
samtools index COH1.sorted.bam
with script: for f in *.fas; do ../sam-align.bash $f; done
3c. Less strict call: bcftools mpileup -Ou -f ../ref.fas *.sorted.bam | bcftools call -mv --ploidy-file ploidy.txt -Ob -o calls.bcf -P 0.05 (or -P 0.1; large P value for less strict call, default 1.1e-3)
# 3b. bcftools mpileup -Ou -f ../ref.fas *.sorted.bam | bcftools call -mv --ploidy-file ploidy.txt -Ob -o calls.bcf, with default ploidy as 1:
weigang@wallace:~/cov-03-09-2020/cov57$ cat ploidy.txt
* * * M 1
6a. bcftools view -m2 -M2 --types snps calls.bcf > snps.bcf ( get only biallelic SNPs)
6b. vcftools --vcf input_file.vcf --remove-indels --recode --recode-INFO-all --out cov.vcf # filter SNPs only
7. filter sites by allele counts: only informative sites
bcftools view snps.bcf > snps.vcf
vcftools --vcf snps.vcf --mac 2 --recode --recode-INFO-all --out snps2.vcf
Pipeline
######################
Host & Enviroment: wqiu@bioit.hunter.cuny.edu
vcftools & clonalframe "source activate gbs"
bcftools: "source activate ngs"
1. align fastq to ref
1) index reference genome
bwa index B111.fa
=> 5 files: amb, ann, bwt, pac, sa
2) align reads to ref
ls -1 *.gz | cut -d'.' -f1 | sort -u > sample.list
byobu
cat sample.list | while read line; do bwa mem B111.fa ${line}.R1.fastq.gz ${line}.R2.fastq.gz > $line.sam; done
=> sam file
2. convert to bam, sort by ref coordinates
cat sample.list | while read line; do samtools view -F 4 -Sbh ${line}.sam | samtools sort -o ${line}.bam; done
=> acc.bam
1+2: wrapped to save space
cat sample.list | while read line; do
begin=$(date +"%D:%H:%M")
echo -ne "$line ... started $begin ...";
bwa mem B111.fa ${line}.clean.1.fastq.gz ${line}.clean.2.fastq.gz > $line.sam 2> /dev/null;
bwa_time=$(date +"%D:%H:%M")
echo -ne "sam file generated: $line.sam on $bwa_time ...";
samtools view -F 4 -Sbh ${line}.sam | samtools sort -o ${line}.bam 2> /dev/null;
bam_time=$(date +"%D:%H:%M")
echo -ne "bam file generated: $line.bam on $bam_time ...";
rm $line.sam;
echo "sam file deleted. Done";
done
3. index
cat sample.list | while read line; do samtools index ${line}.bam; done
=> acc.bam.bai
4. Variant Call
1) make ploidy.txt file
cat > ploidy.txt
* * * M 1
2) pileup and make bcf file
bcftools mpileup -Ou -f B111.fa *.bam | bcftools call -mv --ploidy-file ploidy.txt -Ob -o calls.bcf -P 0.05
((or -P 0.1; large P value for less strict call, default 1.1e-3))
=> calls.bcf
5. analyse calls.bcf; remove outlier SNPs and samples
1) check stats
bcftools stats calls.bcf > call.stats
ts/tv (transition/transversion) better greater than 3
check AF freq, remove the first class if necessary (e.g., vcf --maf 0.008)
check counts:
vcftools --vcf snps.vcf --counts --out snps
Filter by maf counts (at least 2):
vcftools --vcf snps-255.recode.vcf --recode --recode-INFO-all --out snps2 --mac 2
2) get only biallelic SNPs
bcftools view -m2 -M2 --types snps calls-87.bcf > snps-87.vcf
bcftools stats snps.vcf | ll
bcftools view -m2 -M2 --types snps call-49.vcf > snps-49.vcf
3) merge samples
bgzip snps-87.vcf
bgzip snps-49.vcf
=> vcf.gz file
bcftools index snps-87.vcf.gz
bcftools index snps-49.vcf.gz
=> vcf.gz.csi file
bcftools merge -Ob snps-87.vcf.gz snps-49.vcf.gz > snps-136.bcf
get only biallelic SNPs
bcftools view -m2 -M2 --types snps snps-136.bcf > snps-136.vcf
ln -s snps-136.vcf snps.vcf
# use vcftools to remove invariant sites, in case samples are dropped:
vcftools --gzvcf snps2.vcf.gz --non-ref-ac-any 1 --recode --recode-INFO-all --out tmp --remove-indv IND
6. vcf to fasta
1) modify sample name (should use "bcftools reheader -s change-id.txt -o tmp.vcf snps.vcf")
cat snps.vcf | sed 's/.bam//g; s/.sorted//g; s/batch-..//g' > tmp.vcf
mv tmp.vcf snps-136.vcf
2) sample list
bcftools query -l snps.vcf > sample.txt
3) make fasta: could be gzipped
cat sample.txt | while read line; do echo ">$line"; bcftools query -s "$line" -f '[%TGT]' snps.vcf; echo; done > sample.fas
Note: . in fas file means missing nt, handled correctly iqtree
4) get ref seq
echo ">B31" > ref.fas
ll snps.vcf => get ref id
grep "^Chromosome" snps.vcf | cut -f4 | paste -s -d '' - >> ref.fas
#grep "^CP021772" snps.vcf | cut -f4 | paste -s -d '\0' - >> ref.fas (#if on apple system)
cat ref.fas >> sample.fas
=> 137 samples, 46783 snps
go to genometracker:
scp sample.fas snps-136.vcf weigang@genometracker.org:/mnt/bac_genome/GBS-Wu-Oct-2022/.
on genometracker:
ln -s snps-136.vcf snps.vcf
# subset samples (e.g., bbss only):
bcftools view -Ov -S samples-bbss.txt --force-samples snp5-lp17.vcf > snp5-lp17-bbss.vcf
7. make tree (with iqtree, for SNP-only alignment, with bootstrap; can't have constant sites)
iqtree2 -s sample.fas -m GTR+ASC -B 1000 -nt AUTO (-n AUTO to use all CPUs on the cluster)
# if containing full seq alignment with constant sites, e.g., HIV env gene alignment
# iqtree -s $work_dir/test.fas -m GTR+F+G -B 1000 --redo -nt AUTO
=> sample.fas.contree
8. consequence call
1) download ref in genbank format
NCBI nucleotide database: search CP021772
=> B111.gb
2) convert genbank to gff3 format
(1) py file: modified from https://dmnfarrell.github.io/bioinformatics/bcftools-csq-gff-format
=> gb2gff3.py
(2) ./gb2gff3.py B111.gb
=> B111.gff3
(3) change acc to match ref name in snps.vcf
cat B111.gff3 | sed 's/^CP021772.1/CP021772/' > tmp.gff3
mv tmp.gff3 B111.gff3
3) call consequence (to tsv or bcf files)
bcftools csq -f B111.fa -g B111.gff3 snps.vcf -Ot -o snps-csq.tsv
cut -f2,5,6 snps-csq.tsv | tr '|' '\t' | cut -f1-5,7- > snps-csq2.tsv
9. web development
1) orf info from genbank
perl get-orf-by-acc.pl CP021772 > orf.csv
2)
scp weigang@genometracker.org:/mnt/bac_genome/GBS-Wu-Oct-2022/sample.fas.contree .
#biotree -m sample.fas.contree | biotree --ref 'B111' > sample.dnd
#biotree -r 'GBS02' sample.fas.contree | biotree --ref 'B111' > sample.dnd
#biotree -E 0.005 sample.fas.contree | biotree -r 'GBS02' | biotree --ref 'B111' > sample.dnd
biotree -D 90 sample.fas.contree | biotree -r 'GBS02' | biotree --ref 'B111' > tree.dnd
tree visualization by R or PhyloView or R/ggtree
3)
scp weigang@genometracker.org:/mnt/bac_genome/GBS-Wu-Oct-2022/snps-csq2.tsv .
4) pheno.csv
clonal frame pipeline (WGS)
- Reconstitute whole-genome alignment from vcf; following this post: https://gatk.broadinstitute.org/hc/en-us/community/posts/360070002671-converting-multisample-vcf-to-fasta. Algorithm: split vcf into single-sample vcf's; use "bcftools consensus" to obtain alternate ref seqs. Environment: conda activate ngs (on bioit)
- create one-sample vcf's
cat ../samples-bbss.txt | while read line; do bcftools view -Ov -s $line ../bbss-cp26.vcf.gz > snp5-cp26-$line.vcf; done
- bgzip & tabit
for f in *.vcf; do bgzip $f; tabix $f.gz; done (or bcftools index) for f in snp5-lp54-*.vcf; do bgzip $f; bcftools index $f.gz; done
- Get consensus
From doc: "Create consensus sequence by applying VCF variants to a reference fasta file. By default, the program will apply all ALT variants to the reference fasta to obtain the consensus sequence. Using the --sample (and, optionally, --haplotype) option will apply genotype (haplotype) calls from FORMAT/GT." tail -27 ../samples-bbss.txt | while read line; do cat ../../B31-files/cp26_plasmid.fasta | bcftools consensus --sample $line snp5-cp26-$line.vcf.gz | sed "s/>cp26/>$line/" > bbss-cp26-$line.fa; done
- Add reference:
cat ../../B31-files/cp26_plasmid.fasta | sed "s/>cp26/>B31/" > bbss-cp26-B31.fa
concatenate & check length: cat *.fa > wgs-cp26.fasta bioseq -l wgs-cp26.fasta
check with bioaln for variability conda activate gbs bioaln -i 'fasta' -m wgs-cp26.fasta | less
- run ClonalFrame (conda env "gbs")
srun ClonalFrameML ss-cp26.dnd wgs-cp26.fasta wgs_cp26 -kappa 4.00 -emsim 100
Align two assemblies
- With minimap2: https://github.com/lh3/minimap2
minimap2 -ax asm5 ref.fa asm.fa > aln.sam # assembly to assembly/ref alignment
"For cross-species full-genome alignment, the scoring system needs to be tuned according to the sequence divergence."
"-au options: asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5% sequence divergence"
- With MUMMER4 (MUMMER4): align two genomes, output delta file:
- nucmer -p A909-COH1 COH1.fa A909.fa
- dnadiff -p A909-COH1 -d A909-COH1.delta
- less A909-ref.report, OR
grep AvgIdentity A909-ref.report - output sam file
- nucmer --sam-long=COH1 B111.fa COH1.fa
- samtools view -b COH1.sam -T B111.fa > COH1.bam
- samtools sort COH1.bam -o COH1.sorted.bam
- samtools index COH1.sorted.bam
- Use GSAlign
conda config --add channels defaults conda config --add channels bioconda conda config --add channels conda-forge conda install gsalign gsalign index ref.fas cov gsalign -i cov -q test.fas
- bcf annotate with gff file:
bcftools csq -f ../ensembl-B31-downloads/lp54.fa -g ../ensembl-B31-downloads/lp54.gff3 -Ov -o lp54.anno.vcf lp54.vcf
- variant call with bcftools: https://samtools.github.io/bcftools/howtos/variant-calling.html
- bcftools cheatsheet: https://gist.github.com/elowy01/93922762e131d7abd3c7e8e166a74a0b
BERT classifier
- Project start: Winter 2020
- Project team: Saadmanul Islam <Saadmanul.Islam91@myhunter.cuny.edu>
- Tutorial page: https://medium.com/swlh/a-simple-guide-on-using-bert-for-text-classification-bbf041ac8d04
- Data set: bioluminascence
- Goal: cross validation
Estimate LD50 using GLM
## curves
library(dplyr)
library(ggplot2)
library(growthcurver)
library(reshape2)
library(purrr)
setwd("/Users/desireepante/Desktop/Programming")
OD20<-read.csv("OD_0220.csv")
OD220<-OD20[-c(6,11:12,20,26:28, 32:33,45:47),]
od <- filter(OD220, IPTG == 0);
#N15
od15d <- mutate(od15d, od.norm = OD/max(OD))
test.1<-glm(min ~ OD, data= od15d, family= "binomial")
ilink<-family(test.1)$linkinv
test.1.pd <- with(od15d,
data.frame(min = seq(min(min), max(min),
length = 10)))
test.1.pd <- cbind(test.1.pd, predict(test.1, test.1.pd, type = "link", se.fit = TRUE)[1:2])
test.1.pd <- transform(test.1.pd, Fitted = ilink(fit), Upper = ilink(fit + ( se.fit)),
Lower = ilink(fit - ( se.fit)))
test.test<-ggplot(od15d, aes(x = min, y = od.norm)) +
geom_ribbon(data = test.1.pd, aes(ymin = Lower, ymax = Upper, x = min),
fill = "steelblue2", alpha = 0.2, inherit.aes = FALSE) +
geom_line(data = test.1.pd, aes(y = Fitted, x = min)) +
geom_point()
test.test
1k genome project/VCFTools
# Extract APOL1 locus
vcftools --gzvcf ALL.chr22.phase3_shapeit2_mvncall_integrated_v5a.20130502.genotypes.vcf.gz --from-bp 36253071 --to-bp 36267530 --recode --stdout --recode-INFO-all --chr 22 | gzip -c > apol1.vcf.gz
# allele frequencies/counts
vcftools --vcf pvt1.recode.vcf --keep AFR.supergroup --counts --out afr
# pi
# Fst
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop AMR.supergroup --vcf pvt1.recode.vcf --out AFR-AMR --remove-indels
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop EAS.supergroup --vcf pvt1.recode.vcf --out AFR-EAS --remove-indels
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop EUR.supergroup --vcf pvt1.recode.vcf --out AFR-EUR --remove-indels
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out AFR-SAS --remove-indels
vcftools --weir-fst-pop AMR.supergroup --weir-fst-pop EAS.supergroup --vcf pvt1.recode.vcf --out AMR-EAS --remove-indels
vcftools --weir-fst-pop AMR.supergroup --weir-fst-pop EUR.supergroup --vcf pvt1.recode.vcf --out AMR-EUR --remove-indels
vcftools --weir-fst-pop AMR.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out AMR-SAS --remove-indels
vcftools --weir-fst-pop EAS.supergroup --weir-fst-pop EUR.supergroup --vcf pvt1.recode.vcf --out EAS-EUR --remove-indels
vcftools --weir-fst-pop EAS.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out EAS-SAS --remove-indels
vcftools --weir-fst-pop EUR.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out EUR-SAS --remove-indels
# concatenate vcf from different chromosomes
vcf-concat apol1-exon-6-snps.vcf tvp23-exon-1-snps.vcf hpr-exon-5-snps.vcf > 3-exons.vcf
# vcf to tabular format
bcftools query -f '%CHROM\t%POS\t%ID\t%REF\t%ALT[\t%SAMPLE=%GT]\n' 3-exons.vcf > tmp
vcf-query -f '%CHROM\t%POS\t%ID\t%REF\t%ALT[\t%SAMPLE=%GT]\n' 3-exons.vcf > tmp
Ggplot2 tips
- Data binning and nice histograms with density and boxplot:
# numerical vector as factor so that it is sorted numerically (no need for as.character())
x.df$train.size <- as.factor(x.df$train.size)
# jitter by group with "position_jitterdodge()"
x.df %>%
ggplot(aes(x=rate.cat, y=accuracy, color=group)) +
geom_boxplot(position=position_dodge(0.8)) +
geom_jitter(position=position_jitterdodge(0.8)) +
facet_wrap(~train.size, nrow = 1) + ylim(0,1) +
geom_abline(intercept = 0.5, slope = 0, linetype="dashed") +
theme(legend.position = "bottom")
# line plot with multiple factors with "interaction()"
rec.df %>%
ggplot(aes(x = tissue, y = rec.rate)) +
geom_boxplot(outlier.shape = NA, aes(fill = tissue), alpha = 0.5) +
geom_point(size = 3, alpha = 0.5, aes(color = symptom)) +
geom_line(aes(group = interaction(id, timepoint)), linetype = 2) +
theme_bw() +
scale_fill_manual(values = c("lightgreen", "lightpink")) +
ylab("Num Rec frags") +
xlab("tissue") +
scale_y_log10()
Capture results in R/GA example
# in general use
lapply(seq_along(x), function(i) {name=names(x}[i])
# to capture names
# save to a data.frame
# bind into a single data.frame using dplyr function:
x.df <-bind_rows(x.rate)
library(stringdist)
library(ggplot2)
out.fit <- lapply(seq(from = 5,to = 150, by = 5), function (num.epi) {
num.alle <- 20; # num of antigens
epi.fit <- function(x) { # fitness defined by the minimum pair diff
x.list <- split(x, rep(1:num.alle, each=num.epi))
# sum(seq_distmatrix(x.list, method = "hamming"))/(num.alle * (num.alle-1) / 2)/num.epi # average pairwise diff
min(seq_distmatrix(x.list, method = "hamming"))/num.epi # min diff
}
epi.ga <- ga(type = "binary", fitness = epi.fit, nBits = num.epi * num.alle)
c(all = num.alle, epi = num.epi, min.pair.dist = epi.ga@fitnessValue)
})
epi.df <- t(as.data.frame(out.fit))
rownames(epi.df) <- 1:nrow(epi.df)
ggplot(as.data.frame(epi.df), aes(x=epi, y=min.pair.dist)) + geom_point() + geom_line()
NCI Cloud (Seven Bridges)
- Documentation: http://www.cancergenomicscloud.org/controlled-access-data/
- API Documentation (to access meta-data)
- Steps (June 20, 2018)
- Create project
- Data -> Data Overview -> Select cancer type -> Data Browser
- Copy files to project
- Go to project, "add filter", filter by "experimental strategy" (RNA-SEQ, miRNA-SEQ)
- To download files: select & Download link; run
aria2c -i download-links.txt
- To download meta data: Download manifest
- Steps (better)
- Create project
- Search "Public Apps"
- Load data & Run
- Steps (a little hard to follow)
- Create project
- Data -> Data Overview -> Select cancer type -> Data Browser
- Click File to add property (e.g., "miRNA") -> "Copy Files to Project" -> choose project to add & add a tag to the files
- Go to Project -> Files -> filter files by tag name -> select -> Save
- Choose a public protocol/workflow (e.g., RNA-SEQ alignment)
- Add index and GTF files
- Go to Project -> task -> run
Reloop a circular plasmid from PacBio assembly
- Input file: Z9-cp26.fa (containing overlapping ends); b31-cp26.fa (reference)
- Find overlap ends by blasting against itself: blastn -task megablast -query Z9-cp26.fa -subject Z9-cp26.fa -evalue 1e-100 -outfmt 6
- The result says “1 -7617” is the same as “26489-34118”, so we use bioseq to remove overlapping part: bioseq –s”1,26488” Z9-cp26.fa > Z9-cp26.fa2
- Run numcer against b31-cp26 to identify the starting position: nucmer --coord ../b31-cp26.fa Z9-cp26.fa2
- The result says the first base of B31 corresponds to 22171 at Z9-cp26, so we run bioseq to reloop: bioseq –R 22171 Z9-cp26.fa2 > Z9-cp26.fa3
- Run numcer to confirm: nucmer --coord ../b31-cp26.fa Z9-cp26.fa3
KEGG REST API
# Author: Edgaras Bezrucenkovas
# Date: Nov 12, 2017
#KEGG API
#Obtain module pathways and orthologs from KEGG pa14 database
#Import module to fetch the data from KEGG database
import urllib.request
import re #Regular expressions
#Get PA14 modules
kegg_db = "http://rest.kegg.jp/link/module/pau"
pa14_mdata = urllib.request.urlopen(kegg_db).read().decode('utf-8').splitlines()
pa14_mods = []
for line in pa14_mdata:
line = line.split("\t")
mod = line[1].strip("md:pau_")
pa14_mods.append(mod)
#Get PA14 genes
kegg_db = "http://rest.kegg.jp/link/pau/module"
pa14_gdata = urllib.request.urlopen(kegg_db).read().decode('utf-8').splitlines()
pa14_genes = []
for line in pa14_gdata:
gdata = line.split("\t")
gdata[0] = gdata[0].strip("md:pau_")
gdata[1] = gdata[1].strip("pau:")
pa14_genes.append(gdata)
#Open the file containing KEGG compounds ids
id_file = open("kegg-entries.txt")
kegg_ids = id_file.readlines()
compound_ids = []
for cid in kegg_ids:
cid = cid.strip("\n")
compound_ids.append(cid)
id_file.close()
#Get module pathway ids
for cid in compound_ids:
kegg_db = "http://rest.kegg.jp/link/module/compound:"+cid
module_data = urllib.request.urlopen(kegg_db).read().decode('utf-8').splitlines()
module_ids = []
for line in module_data:
if re.match("cpd", line):
line = line.split("\t")
m_id = line[1].strip("md:")
module_ids.append(m_id)
else:
module_ids.append("NA")
#Filter module pathway ids
modules_final = []
for m_id in module_ids:
if m_id == "NA":
modules_final.append("NA")
elif m_id in pa14_mods:
modules_final.append(m_id)
if not modules_final:
modules_final.append("NA")
#Get genes
genes = {}
for m_id in modules_final:
key = m_id
genes.setdefault(key, [])
if m_id == "NA":
genes[key].append("NA")
else:
for i in pa14_genes:
if m_id == i[0]:
genes[key].append(i[1])
#Get module names using module ids
module_names = {}
for m_id in modules_final:
if m_id == "NA":
m_name = {"NA":"NA"}
module_names.update(m_name)
else:
kegg_db = "http://rest.kegg.jp/list/module:"+m_id
module_data = urllib.request.urlopen(kegg_db).read().decode("utf-8").split("\t")
module_name = module_data[1].strip("\n")
m = {m_id:module_name}
module_names.update(m)
#Output
for k, v in genes.items():
for i in v:
print(cid,k,i,module_names.get(k), sep = "\t")D3js Tutorial
- Install brackets editor from adobe: http://brackets.io/
- Enable web server & create a directory "public_html" in your home directory
- Create the following file structure: test/index.html; test/js/index.js; test/css/index.css
- Basic D3: following this link
- Metabolomics: following this link
Transform a wide data frame to a long one
- A function in R
df2long = function(x, varname, cname, rname){
num.col = dim(x)[2]
x$tmp = rownames(x)
y = reshape(x, varying=1:num.col, v.names=varname, timevar=cname, times=names(x)[1:num.col], direction="long")
y=y[,-4]
rownames(y)=NULL
colnames(y)[1] = rname
y
}
- A function in Perl
#!/usr/bin/env perl
# expect a data frame with row and col headings
use strict;
use warnings;
use Data::Dumper;
my $first = 0;
my @colnames;
my %data;
while(<>) {
chomp;
$first++;
if ($first == 1) {
@colnames = split;
next;
}
my @data = split;
my $rowname = shift @data;
for (my $i=0; $i<=$#data; $i++) {
$data{$rowname}->{$colnames[$i]} = $data[$i];
}
}
#print Dumper(\%data);
foreach my $row (keys %data) {
foreach my $col (@colnames) {
print $row, "\t", $col, "\t", $data{$row}->{$col}, "\n";
}
}
exit;
Variant call with samtools/bcftools & variant verification using IGV
- mpileup:
samtools mpileup -uf ref.fa sorted1.bam sorted2.bam ...
- call variants:
bcftools call -mv > var.raw.vcf OR: bcftools call -c -v --ploidy 1 gbs-50.mpileup > raw.vcf
- extract only SNP sites:
vcftools --vcf input_file.vcf --remove-indels --recode --recode-INFO-all
- filter by quality:
bcftools filter -i '%QUAL>200' gbs50-snps.recode.vcf > gbs50-snps2.vcf
- check by TsTv:
bcftools stats gbs50-snps2.vcf | grep TSTV
- Extract SNPs into Fasta:
- Or, with bcftools:
bcftools query -l gbs50-snps2.vcf > samples
cat samples | while read line; do echo ">$line"; bcftools query -s "$line" -f '[%TGT]' gbs50-snps2.vcf; echo; done > samples.fas
- get ref seq:
echo ">ref" >> sample.fas; grep "^CP" gbs50-snps2.vcf | cut -f4 | paste -s -d >> sample.fas
- Visualization with IGB
- Prepare & load reference genomes
- Load FASTA:
bioseq -i'genbank' ref.gb > ref.fas
- Prepare GFF3 file:
bp_genbank2gff3.pl --CDS --filter exon --filter gene /home/chongdi/michelle/pa_rp73.gb
- Prepare BAM files (see below on how to index and align reads using bwa and samtools, in "ospC Amplicon")
- Index sorted bam files with samtools & load BAM files (multiple bam files okay)
KRAKEN
- assigns taxonomic labels to short DNA reads by examining the k-mers within a read and querying a database with those k-mers:
kraken -db /belfer-ebox/projects/old_backup/qiulab/minikraken_20141208 --fastq-input 02015P1_S18_L001_R1_001.fastq.gz 02015P1_S18_L001_R2_001.fastq.gz --gzip-compressed --output outfile --paired
- summarize taxonomy:
kraken-translate --db /belfer-ebox/projects/old_backup/qiulab/minikraken_20141208 outfile > predict.file
- count unique strains:
pat-8]$ cut -f2 s75.predict | cut -f10 -d';' | grep "^[a-zA-Z]" | sort | uniq -c | sort -rn.
- Pick the strain with the highest counts as the reference genome
PATRIC microbial genome annotation CLI
- Install Debian distribution from github: https://github.com/PATRIC3/PATRIC-distribution/releases/tag/1.015
- Tutorial: http://tutorial.theseed.org/PATRIC-Tutorials/
- Fetch all genomes from a genus:
p3-all-genomes --in genome_name,Borrelia > Borrelia.genomes; p3-get-genome-data -i Borrelia.genomes -e genome_status,complete > Borrelia-complete.genomes
- Retrieves features from coding sequences only: input file must be a list of genome ids with a header!
p3-get-genome-features -i $file -e feature.feature_type,CDS -a pgfam_id -a patric_id -a plfam_id -a start -a end -a strand -a genome_name -a product -a accession > ${name}-all-features.txt
- Retrieve feature sequence:
p3-echo -t feature.accession "fig|100177.4.peg.1" | p3-get-feature-sequence --dna
- Submit genomes for annotation
- Log in: p3-login user name/password
- Submit a genome for annotation:
submit-patric-annotation --scientific-name "Pseudomonas aeruginosa" --taxonomy-id 287 --genetic-code 11 --domain Bacteria --log pa.log /weigang@patricbrc.org/home/wsdir gid_5.fas
submit-patric-annotation --scientific-name "Streptococcus agalactiae" --taxonomy-id 1311 --genetic-code 11 --domain Bacteria --log sa-1.log /weigang@patricbrc.org/home/wsdir sa-1.fas
- Message: "Uploading gid_5.fas to workspace at /weigang@patricbrc.org/home/wsdir/gid_5/gid_5.fas”
- Create genome groups
- login
cat trep.complete.ids | p3-put-genome-group "Treponema complete”
p3-get-genome-group "Treponema complete”
Parsimony reconstruction using MPR
# MPR for each column
plot.mpr <- function(column=1) {
plot.phylo(tr.unrooted, main = paste(colnames(ph.t)[column]))
tmpr<-MPR(ph.t[,column], tr.unrooted, outgroup = "gid_1311.1320")
nodelabels(paste("[", tmpr[, 1], ",", tmpr[, 2], "]", sep = ""))
tiplabels(ph.t[,column][tr.unrooted$tip.label], adj = -2)
}
# add internal node states
datalist <- data.frame(fam=character(), a=numeric(), b=numeric(), c=numeric())
for (i in 1:ncol(ph.t)) {
#for (i in 1:10) {
tmpr<-MPR(ph.t[,i], tr.unrooted, outgroup = "gid_1311.1320");
out<-c(colnames(ph.t)[i],tmpr[,1])
datalist <- rbind(datalist, data.frame(fam=colnames(ph.t)[i], a=tmpr[1,1], b=tmpr[2,1], c=tmpr[3,1]))
}
#plotting gains and losses
tr.unrooted <- unroot(tr)
gains<-apply(ph.node.states[,9:15], 2, function(x) length(which(x>0)))
losses<-apply(ph.node.states[,9:15], 2, function(x) length(which(x<0)))
plot(tr.unrooted)
edgelabels(gains, adj = c(0.5,-0.25), col=2, frame= "none")
edgelabels(losses, adj = c(0.5,1.25), col=4, frame= "none")Amplicon NGS sequencing
Nanopore reads of ospC amplicons from ticks (Fall 2025)
# To index onto a reference fasta:
minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa
# This was for initial mapping, generated .sam files that were named "barcode#.f#.sam"
# needed them numbered because there were hourly fastq files for this data
i=0;
for file in *.gz; do
i=$((i+1));
barcode_num=$(echo "$file" | sed -E 's/.*barcode([0-9]{2}).*/\1/');
output_name="barcode${barcode_num}.f$(printf "%02d" $i).sam";
echo "Processing $file -> $output_name";
minimap2 -ax map-ont /scratch/weigang/ospC-ref-nuc.fas "$file" > "$output_name";
done
# convert to binary file & sort reads
samtools view –b sample.sam > sample.bam
samtools sort sample.bam sample.sorted.bam
# can do this for all sam tools, just need to make sure you change the *.sam in the beginning, the output_name= in the beginning, and then it should work
for f in *.sam; do
output_name="${f%.sam}.bam";
echo "Converting $f to $output_name";
samtools view -b "$f" > "$output_name";
done
#need to change the .bed location if using a different .bed file
for p in $(ls *sorted.bam | sed 's/\.f[0-9]\{2\}\.sorted\.bam//' | sort -u); do
echo "Processing $p...";
for f in "$p".f*.sorted.bam;
do
bedtools coverage -abam "$f" -b /scratch/weigang/ospC.bed -d | cut -f1,4,5 | grep -v -w "0$" | while read line; do echo -e "$p\t$line";
done;
done > "$p".cov;
done
Illumina reads (2022)
#Index nucleotide file:
bwa index ref.fa
#align:
bwa mem ref.fa sample_read1.fq sample_read2.fq > sample.sam
#BAM output:
samtools view -b sample.sam > sample.bam
#Sort & index BAM file:
samtools sort -o sample.sorted sample.bam
samtools index sample.sorted
# Calculate coverage by bedtools (better, raw read coverages)
Based on the update: https://bioinformatics.stackexchange.com/questions/2318/how-to-count-reads-in-bam-per-bed-interval-with-bedtools
bedtools bamtobed -i sample.sorted > sample.bed # bam to bed
bedtools coverage -b sample.bed -a ospC.bed > sample.coverage
Alternatives (not good):
bedtools coverage -b sample.sorted.bam -a refs.bed -d > sample.bedtools.cov # per-site
bedtools coverage -b sample.sorted.bam -a refs.bed -counts > sample.bedtools.cov # average
# Generate VCF file (not needed for coverage)
samtools mpileup -uf ref.fa s18.sorted.bam s56.sorted.bam > test.mpileup
bcftools call -c -v test.mpileup > test.raw.vcf
#R plot
# BASH script from Tony Fung & Jamie Cabigas (Spring 2019)
#!/usr/bin/env bash
# ----------------------------------------
# File : fas-to-vcf.sh
# Author : Tony Fung & Jamie Cabigas
# Date : March 21, 2019
# Description : Batch convert FAS files to VCF files
# Requirements : samtools 1.9, bcftools 1.9, bwa 0.7.12
# Input : reference file, format of sequence files, up to 7 sequence id's
# Sample Command : bash fas-to-vcf.sh ref.fasta fastq ERR221622 ERR221661 ERR221662 ERR221663
# Output : up to 7 VCF files
# ----------------------------------------
if [ $# -lt 3 ]
then
echo "Usage: bash $0 <ref_file> <format_of_sequence_files> <sequence_id> [<sequence_id_2> <sequence_id_3> etc.]";
exit;
fi
for arg
do
if [ $arg == $1 ]
then
ref_file="../$1";
elif [ $arg == $2 ]
then
file_format=$2;
else
seq_id=$arg;
fas_file_1="${seq_id}_1.$file_format";
fas_file_2="${seq_id}_2.$file_format";
pwd;
cd $seq_id;
pwd;
# Index nucleotide file:
bwa index $ref_file;
# Align:
bwa mem $ref_file $fas_file_1 $fas_file_2 > $seq_id.sam
# BAM output:
samtools view -b $seq_id.sam > $seq_id.bam
# Sort & index BAM file:
samtools sort $seq_id.bam -o $seq_id.sorted.bam
samtools index $seq_id.sorted.bam
# Generate VCF file:
# -u is deprecated, use bcftools mpileup instead
# samtools mpileup -uf $ref_file $seq_id.sorted.bam > $seq_id.mpileup
bcftools mpileup -f $ref_file $seq_id.sorted.bam > $seq_id.mpileup
bcftools call -c -v $seq_id.mpileup > $seq_id.raw.vcf
cd ..;
pwd;
fi
done
Running a Screen Session
use byobu
- start a screen session by typing "byobu"
- run commands
- Detach by pressing "F6"
- Reattach by typing "byobu"
- Terminate by typing "exit"
use screen
- Start a screen session
screen
- Detach the running mission
ctrl + A + D
- Show the list of running process
screen -ls
- Reattach a running process
screen -r ProcessID
- Terminate a process
ctrl + A
:quit
Bp-utils: sequence, alignment & tree utilities by Qiu Lab
bioseq: sequence/FASTA manipulations
- Use accession "CP002316.1" to retrieve the Genbank file from NCBI. Save the output (in genbank format) to a file named as "cp002316.gb".
bioseq -f "CP002316.1" -o'genbank' > cp002316.gb
- Use the above file as input, extract FASTA sequences for each genes and save the output to a new file called "cp002316.nuc". Use this file for the following questions.
bioseq -i "genbank" -F cp002316.gb > cp002316.fas
- Count the number of sequences.
bioseq -n cp002316.fas
- In a single command, pick the first 10 sequences and find their length
bioseq -p "order:1-10" cp002316.fas | bioseq –l
- In a single command, pick the third and seventh sequences from the file and do the 3-frame translation. Which reading frame is the correct on both? Specify
bioseq -p "order:3,7" cp002316.fas | bioseq -t3
- Find the base composition of the last two sequences
bioseq -p "order:25-26" cp002316.fas| bioseq –c
- Pick the sequence with id "Bbu|D1_B11|8784|9302|1" and count the number of codons present in this sequence
bioseq -p "id:BbuJD1_B11|8784|9302|1" cp002316.fas | bioseq –C
- Delete the last 10 sequences from the file and save the output to cp002316-v2.nuc
bioseq -d "order:17-26" cp002316.fas > cp002316-v2.nuc
- In a single command, pick the first sequence, then get the 50-110 nucleotides and make reverse complement of the sub-sequences
bioseq -p "order:1" cp002316.fas | bioseq -s "50,110" | bioseq –r
- In a single command, get the first 100 nucleotides of all the sequences present in the file and do 1-frame translation of all sub-sequences.
bioseq -s "1,100" cp002316.fas | bioseq -t1
bioaln: alignment/CLUSTALW manipulations
- Go to /home/shared/LabMeetingReadings/Test-Data and find the sequence alignment file “bioaln_tutorial.aln”. Name the format of the alignment file. Use it to answer all the questions below.
CLUSTALW
- Find the length of the alignment.
bioaln -l bioaln_tutorial.aln
- Count the number of the sequences present in the alignment.
bioaln -n bioaln_tutorial.aln
- How do you convert this alignment in phylip format? Save the output.
bioaln -o "phylip" bioaln_tutorial.aln > test.phy
- Pick “seq2, seq5, seq7, seq10” from the alignment and calculate their average percent identity.
bioaln -p "seq2, seq5, seq7, seq10" bioaln_tutorial.aln | bioaln -a
- Get an alignment slice from “50-140” and find the average identities of the slice for sliding windows of 25.
bioaln -s "50, 140" bioaln_tutorial.aln | bioaln -w "25"
- Extract conserved blocks from the alignment.
bioaln -B bioaln_tutorial.aln
- Find the unique sequences and list their ids.
bioaln -u bioaln_tutorial.aln | bioaln -L
- Extract third sites from the alignment and show only variable sites in match view.
bioaln -T bioaln_tutorial.aln | bioaln -v | bioaln -m
- Remove the gaps and show the final alignment in codon view for an alignment slice “1-100”.
bioaln -s "1, 100" bioaln_tutorial.aln | bioaln -g | bioaln -c
- Add a 90% consensus sequence and then show the final alignment in match plus codon view for an alignment slice “20-80”. (Hint: match view followed by codon view)
bioaln -s "20, 80" bioaln_tutorial.aln | bioaln -C "90" | bioaln -m | bioaln -c
biotree: tree/NEWICK manipulations
biopop: SNP statistics
Homology searching and clustering
BLAST+: search("google") for homologs/pariwise alignment
hmmer
- link: http://hmmer.org/
- Installation:
% conda install -c biocore hmmer # Anaconda
- Build profile:
hmmbuild globins4.hmm globins4.sto
- Search:
hmmsearch globins4.hmm uniprot_sprot.fasta > globins4.out
cdhit
cdhit -i all.pep -o all.cdhit -c 0.5 -n 3
Options:
- -i: input file
- -o: output file
- -c: percent identity (below which it is considered different families)
- -n: word length
interproscan
../../software/interproscan/interproscan-5.13-52.0/interproscan.sh -i trep-cdhit.representatives.pep2 -o trep-representatives.tsv -t p -goterms -pa -f tsv
Documentation page: How to run
Programs for producing multiple alignments
MUSCLE
MUGSY
- MUGSY bash
#!/bin/sh
export MUGSY_INSTALL=/home/weigang/mugsy_x86-64-v1r2.2
export PATH=$PATH:$MUGSY_INSTALL:$MUGSY_INSTALL/mapping
export PERL5LIB=$MUGSY_INSTALL/perllibs
#For testing TBA
#export PATH=$PATH:$MUGSY_INSTALL/../../multiz-tba/trunk/
- source the bash file
source mugsyenv.sh
- run mugsy
mugsy --directory /home/chongdi/Streptococcus/mugsy-output -prefix mugsy_aln mugsy-input/*.fa
CLUSTALW
MAFT
TCOFFEE
Programs for producing phylogeny & phylogenetic analysis
IQ-Tree
- Beginner's tutorial
- Advanced tutorial
- Model search (slow!! better done with byobu)
iqtree -s example.phy -m MFP
- protein tree with fast bootstrap:
iqtree -s example.phy -m WAG+I+G -bb 1000 (version 1.xx; -B for latest version)
- site-specific rates:
iqtree -s example.phy -rate
iqtree -s example.phy -wsr (version 1.xx; -t and -m from above to save time)
- ancestral state reconstruction:
iqtree -s example.phy -asr (-t and -m from above to save time)
FastTree
PHYLIP
MrBayes
RaXML
- Required arguments
- -s alignment (in PHYLIP or FASTA)
- -n tag
- Simple run (ML):
raxmlHPC-SSE3 -x 12345 -p 12345 -# autoMRE -s concat.fas -m GTRGAMMA -n tag -q part.txt
- Bootstrap:
raxmlHPC-SSE3 -f a -x 12345 -p 12345 -# 100 -s concat.fas -m GTRCAT -n tag -q part.txt
- Make a file named "part.txt" with the following lines (Chanlge the number to the total length of your alignment):
DNA, gene1codon1 = 1-3765906\3
DNA, gene1codon2 = 2-3765906\3
DNA, gene1codon3 = 3-3765906\3
- The resulting files
- RAxML_bestTree.tag: best tree (no bootstrap)
- RAxML_bipartitionsBranchLabels.tag: ignore
- RAxML_bipartitions.tag: main result. Feed this tree to figtree
- RAxML_bootstrap.tag: ignore
- RAxML_info.tag : log file
- Protein models
raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAS # protein, gamma, Whelan & Goldman (2001) model
raxmlHPC-SSE3 -s protein.phy -n A2 -m PROTGAMMAGTR # protein, gamma, user model
raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAG -# 100 -p 0123 # protein, gamma, Whelan & Goldman (2001) model, bootstrap
raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAG -o Carp,Loach # protein, gamma, Whelan & Goldman (2001) model, root on a (monophyletic group)
raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAS -# autoFC -p 0123 # protein, gamma, Whelan & Goldman (2001) model, bootstrap (at least 99 splits, auto-stopping)
raxmlHPC-SSE3 -f a -s protein.phy -n A1 -m PROTGAMMAWAG -# 100 -p 0123 -x 0123 # Rapid bootstrap with consensus
- output 1, RAXML_bestTree.A1 (ml tree)
- output 2, RAXMLbootstrap.A1 (bootstrap relicates)
- output 3, RAXMLbipartitions.A1 (tree with boot strap values)
PhyloNet
R packages for phylogenetics
APE
Convert a tree to ultrametric using time estimates
t <- read.tree("core-tree-30otus.dnd")
t.ultra <- chronopl(t, 0)
t.hclust <- as.hclust(t.ultra)
t.dendro <- as.dendrogram(t.hclust)
heatmap(ge.var, Rowv=t.dendro) # order the rows with customized tree
phengorn
phytools
Population genetics
LDHat: test of recombination based on 4-gametes
- filter sites:
convert -seq snps.sites -loc snps.locs -freqcut 0.08
- Pairwise LD tests: First generate "lookup" table:
lkgen -lk /usr/local/LDhat/lk_files/lk_n50_t0.001 -nseq 48; then calculate pairwise LD statistics: pairwise -seq sites.txt -loc locs.txt -lk new_lk.txt
- Run interval for recombination hot spots:
interval -seq sites.txt -loc locs.txt -lk new_lk.txt -its 1000000 -bgen 5 -exact
- Get stats:
stat -input rates.txt -loc locs.txt -burn 50 (burnin=100K)
- Plot in R:
x = read.table("rates.txt", skip=1, fill=T);
x = as.matrix(x);
burn.in = 50;
low = as.integer(nrow(x)*burn.in/100);
means<-apply(x[low:nrow(x),], 2, mean, na.rm=T);
q.95<-apply(x[low:nrow(x),], 2, quantile, probs=c(0.025, 0.5, 0.975), na.rm=T);
pos<-as.vector(as.matrix(read.table("locs.txt", as.is=T, skip=1)));
plot(pos[1:(length(pos)-1)], y=means[2:length(means)], type="s", col=rgb(0,0,0.5),
xlab="SNP position (B111)", ylab="Posterior mean recombination rate", main="GBS Strep: recombination by LDhat");
lines(pos[1:(length(pos)-1)], y=q.95[1,2:length(means)], type="s", col=grey(0.75), lty="dotted");
lines(pos[1:(length(pos)-1)], y=q.95[3,2:length(means)], type="s", col=grey(0.75), lty="dotted");
ms: coalescence simulation
SFS: forward simulation
PAML: testing selection with Ka/Ks
Microbial genome databases & pipelines in Qiu Lab
borreliabase
pa2
spiro_genomes/treponema
Blast a set of genes against a bacteria genome
- download genome
- extract gene sequences & translate
- Make blast database
- Run blastp
de novo variant call with cortex_var
Create binary file of fasta genome file.
Run contex_var_31_c1 (cutoff 1 used for 1 genome)
- --se_list is the command the reads the list you want to target (ie: list-genome.txt)
- --kmer_size is the middle size, has to be an odd integer
- --mem_width always choose 17
- --mem_height always choose 100
- --dump_binary Name your file name (ie: Genome.ctx)
/home/weigang/CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1
--se_list list-Evo.txt
--kmer_size 31
--mem_width 17
--mem_height 100
--dump_binary Evo.ctx
> Evo.log save log file
Read each binary file (.ctx) into its own individual color list (ls Evo.ctx > Evo.colorlist)
Then save these lists into their own collective colorlist.txt (ls *.ctx > colorlist.txt)
Reveal genetic variation using the Bubble Caller from cortex_var.
/home/weigang/CORTEX_release_v1.0.5.21/bin/cortex_var_31_c5
--se_list colorlist.txt
--kmer_size 31
--mem_width 17
--mem_height 100
--dump_binary all-colors.ctx
> all-colors.log save log file
Bubble caller will detect differences between each genome by assigning distinct colors to each genome (note that the UK spelling of color is used: colour)
- --multicolour_bin holds your all-colors.ctx binary from the Bubble Caller
- --detect_bubbles1 i/i Detects 1 variation between genomes i and i. i indicates the position number the genome is listed on the colorlist.txt file. If the genome is fourth on the colorlist.txt, for example, its corresponding i variable is 4
- --output_bubbles1 Output variant reads in fasta format (ie: Evo-RefHG.var for bubble detection between
Evolved genome and Reference HG genome)
- --print_colour_coverages necessary for output
/home/weigang/CORTEX_release_v1.0.5.21/bin/cortex_var_31_c5
--kmer_size 31
--mem_height 17
--mem_width 100
--multicolour_bin all-colors.ctx
--detect_bubbles1 0/1
--output_bubbles1 Evo-RefHG.var
--print_colour_coverages
> Evo-RefHG.log save log file
Variant call with cortex_var
Example
- Files
MS00018_S5_L001_R1_001.fastq
MS00018_S5_L001_R2_001.fastq
KU-090401_S3_L001_R1_001.fastq
KU-090401_S3_L001_R2_001.fastq
...
- File content
@M03268:52:000000000-AJFAY:1:1101:16970:1555 1:N:0:7
CCCATGAACGGCACGTTCACGATGCAGAAGGTGGTGACCAGGCCGGTGTCGGCGACCTCGACGTAATCGTCGGTGGGGGA
GCCGTCGCGCGGGTCCGCGCCGCGCGGCGGGAAGTACACCTTGCCGTCCATGCGGGCGCGGGCGCCCAGCAGACGACCCT
CCATGAGCGCATTCAGGAATTCGGCCTCCTGCGGCGCGGCGGTGTGCTTGATATTGAAGTCGACCGGGGTCACGATGCCG
GTGACCGGTT
+
11>1>111@11>1A1FGF1FC0F0A111010GB0ECBFGF0/AFECGGFHECE??EEGHE/EEEHEFHEHHGCEECE??/
<CFCGGCCGCCCCCCHCGGCCCG@G??@@?@-@BFFFFFFFFFFF;B@FBFBFF<?@;@@-=?@??@-EFFFFF@;@@@F
FFBF/BBF;@@FFFFFFFFFFFFF@FFFFFFF<@@@@@@@@@@@FBFFFFFFFFFFFFFFFFF@@@?@?@FFFFFFFBF@
?@@EFF@@<B
@M03268:52:000000000-AJFAY:1:1101:16136:1618 1:N:0:7
TCCTGGCCCGTGAAACCGCTTGCCCGGTACAGGTTCTGGACTACCGCCTGGCACCCGAGCATCCGTTCCCGGCGGCGCTC
GACGACGCCGAGGCGGCGTTCCTGGAACTGGTGGCCGCCGGCTACCGGCCCGAACGCATTGCGGTCGCGGGTGATTCGGCCGGTGGCGGGCTCTCGCTCGCGCTGGCCGAACGGCTGCGCGACCGGCACGGGCTGGTTCCGGCCGCGCTCGGGCTGATCGCGCCCTGGGC
+
11>>11C1A@A?11BDF?EEGAFGFG?ECCHBHHGFG1EGHFHHHCCGGC/GCGGGCEECEFGHGGFFGHGGGGCECCC<CCC@CCCC@CGCCCGGC?:@EBFBF/CFFFF0/CFG?=@=-9>AFF@=@@?@;@@@F--9:BF@A@@?@--;9-BFFFF@A-@99B?-9@?=EFFBAAE;9>?;@@BF@9-@-;@=-E@@@=@@;@?>@9@<?@?BBBFFF;?>;;-@@?@<?@?9-FBFF@-99-9E-9
...
Step 1
- Create matched FASTQ files (python script)
#!/usr/bin/python
from sys import argv
script, File1, File2 = argv
# Create a dictionary listing the sequences in the first file for reference
file1 = open(File1)
dict1 = {}
for line in file1:
if '@M03268' in line:
tag1 = line.rstrip()[:-9]
tail = line.rstrip()[-9:]
dict1[tag1] = []
else:
dict1[tag1].append(line.rstrip())
file1.close()
# Create two output files
f1 = open(File1.replace('.fastq', '_mat.fq'), 'w')
f2 = open(File2.replace('.fastq', '_mat.fq'), 'w')
# Match the sequence
file2 = open(File2)
for line in file2:
if dict1.has_key(line.rstrip()[:-9]): # The has_key method
tag1 = line.rstrip()[:-9]
f1.write(tag1 + tail + '\n')
for j in range(3):
f1.write(dict1[tag1][j] + '\n')
del dict1[tag1]
dict2 = {} # Create a temporary dictionary for sequence in the file2
tag2 = line.rstrip()
dict2[tag2] = []
else:
dict2[tag2].append(line.rstrip())
if len(dict2[tag2]) == 3:
f2.write(tag2 + '\n')
for j in range(3):
f2.write(dict2[tag2][j] + '\n')
file2.close()
f1.close()
f2.close()
Step 2. Clean Fastq Files & Run Single-color Graph & Error Cleaning
- Create a file list showing all outcome files whose extensions need to be changed from _mat.fq to .list
bbduk.sh -Xmx1g in1=fastq_file1 in2=fastq_file2 -out1=clean1.fq -out2=clean2.fq qtrim=rl trimq=20
- Create a file list showing all outcome files whose extensions need to be changed from _mat.fq to .list
for f in *_mat.fq;
do
title=$(echo $f | cut -d'_' -f2);
id=$(echo $f | cut -d'_' -f1);
echo $f > ${id}.list${title};
done
- Single color graph for sample
../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1
--pe_list MS00018_S5.list1,MS00018_S5.list2
--kmer_size 31
--mem_height 17
--mem_width 100
--dump_binary MS00018_S5.ctx
--sample_id MS00018_S5
--remove_pcr_duplicates
--quality_score_threshold 20 > MS00018_S5.log
- Single color graph for reference
../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1
--se_list ref.filelist
--kmer_size 31
--mem_height 17
--mem_width 100
--dump_binary ref.ctx
--sample_id ref 20 > ref.log
- Run Error Cleaning for All Samples (reference is not included)
../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1
--mem_height 18
--mem_width 100
--kmer_size 31
--multicolour_bin N18_S15.ctx
--remove_low_coverage_supernodes 10
--dump_binary N18_S15.cleaned.ctx
Step 3
- Pull the name of each .cleaned.ctx file to a cleaned.list file, then create a .filelist file for all cleaned.list files.
ls file1.cleaned.ctx > file1.cleaned.list
ls file2.cleaned.ctx > file2.cleaned.list
ls ref.ctx > ref.list
ls -1 *.list > ref-sample.filelist
- Multicolour Graph
../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c3
--mem_height 20
--mem_width 100
--kmer_size 31
--colour_list ref-sample.filelist
--dump_binary ref-sample.ctx > ref-sample.log
Step 4
- Variation Discovery Using The Bubble Caller
../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c3
--mem_height 20
--mem_width 100
--kmer_size 31
--multicolour_bin ref-sample.ctx
--detect_bubbles1 -1/-1
--ref_colour 2
--output_bubbles1 bubbles-in-sample.out
--print_colour_coverages
--experiment_type EachColourAHaploidSampleExceptTheRefColour
--genome_size 8000000 > bubbles-in-sample.log
Step 5
- Reference Genome
(When in Cluster execute "module load stampy": doesn't work; path problem)
(Run the following on wallace:)
stampy.py -G ref ref.fa
stampy.py -g ref -H ref
- Turn Into VCF with reference
Make a sample list file (from bubble or multicolor log file):
cat e1-bubbles-in-sample.log | grep CLEANED | cut -f2 > e1.sample.lis
Customize the following command based on your output files, num of colors, index of ref colors, etc
perl /home/weigang/CORTEX_release_v1.0.5.21/scripts/analyse_variants/process_calls-wq.pl --callfile e1-bubbles-in-sample.out --callfile_log e1-bubbles-in-sample.log -outvcf e1-bubbles-in-sample --outdir e1-vcfout --samplename_list e1.sample.list --num_cols 7 --stampy_bin /home/weigang/stampy-1.0.28/stampy.py --stampy_hash ref --refcol 6 --vcftools_dir /usr/local/bin --caller BC --kmer 31 --ploidy 1
Step 6. Parse VCF files
- Filter out low-quality sites:
vcftools --vcf pat-5.decomp.vcf --keep-filtered PASS --recode --out pat-5
- Extract coverage
vcftools --vcf pat-5.recode.vcf --extract-FORMAT-info COV
(output file: out.COV.FORMAT)
- Extract genotypes
vcftools --vcf pat-5.recode.vcf --extract-FORMAT-info GT
(output file: out.GT.FORMAT)
- Extract confidence
vcftools --vcf pat-5.recode.vcf --extract-FORMAT-info GT_CONF
(output file: out.GT_CONF.FORMAT)
- Send GT_CONF file to R and visualize log10(conf) distribution with boxplot
- Use custom PERL file to filter out low-quality (e.g., GT_CONF < 30) genotype calls (flag with "?" or "na"), and make haplotype GT ("1/1" to "1", "0/0" to "0", "./." to "?)
- Verify variants using IGV (see IGV protocol above)
Step 7. Variant Annotation & Visualization
vcf_parser.py out.decomp.vcf ref.gb (the code needs validation)
- Data to database & web visualization, if necessary
hmmer
Annotate proteins with TIGRFAM
hmmsearch --tblout foo.hmmout # table output for all sequences
--domtblout foo.dmout # table output for all domains
-E 0.01 # level of sequence significance
--domE 0.01 # level of domain significance
-o /dev/null # don't show STDOUT
../../TIGRFAMs-Release-15-Sep-17-2014/TIGRFAMs_15.0_HMM.LIB # HMM profile library for tiger fams
GCA_000583715.2_ASM58371v2_protein.faa & # input/query file in FASTA
PopGenome
library(PopGenome)
g = readVCF("pvt1.recode.vcf.gz", 1000, "8", 127890000, 128102000)
pops = split(sample[,1], sample[,2]) # create a list of populations
g = set.populations(g, pops, diploid = T) # set population names
# by windows
slide = sliding.window.transform(g, width = 100, jump = 20) # nsnps, not actual length
slide = F_ST.stats(slide, mode = "nucleotide")
snp.pos = slide@region.data@biallelic.sites # SNP positions
win.num = length(slide@region.names)
win.start = numeric()
for (i in 1:win.num) {win.start[i] = snp.pos[[i]][1]}
fst = slide@nuc.F_ST.vs.all
pop.names = names(slide@populations) # population names
plot(win.start, fst[,1], type ="n", las = 1, ylab = expression(F[st]), xlab = "SNP Position", ylim = c(0,0.4))
for (i in 1:length(slide@populations)) {
lines(win.start, fst[,i], type = "l", col = pop.group[pop.names[i],4])
}
arch.coords=c(127982050, 127992931)
abline(v = arch.coords, col = "orange")
#rect(xleft = arch.coords[1], ybottom = -1, xright = arch.coords[2], ytop = 0.5, border = "transparent", col = 2)Velvet
Cleaning
../../bbmap/bbduk.sh -Xmx1g
in1=WGC067462_hunhewenku_509_combined_R1.fastq # gz file works as well
in2=WGC067462_hunhewenku_509_combined_R2.fastq # gz file works as well
-out1=clean1.fq
-out2=clean2.fq
qtrim=rl
trimq=20
Running Velvet Optimizer
srun ../../VelvetOptimiser-2.2.5/VelvetOptimiser.pl
--t 32
--s 31 --e 31 --x 6 # kmer sizes
-f '-shortPaired -fastq clean1.fq -shortPaired2 -fastq clean2.fq'
-t 4
--optFuncKmer ‘n50’
-p prefix
PacBio assembly with canu
./canu -p staph-auto-5 -d staph-auto-5 genomeSize=2.2m -pacbio-raw pac-reads-5.tar.gz