QuBi/module/bio203-lab12—2018: Difference between revisions

From QiuLab
Jump to navigation Jump to search
imported>Lab
No edit summary
imported>Weigang
 
(18 intermediate revisions by 2 users not shown)
Line 1: Line 1:
<span style="color: Seagreen;font-weight:bold;font-size:large;">Lab 12. Bioinformatics Exercises: BLAST & Genomes>
<span style="color: Seagreen;font-weight:bold;font-size:large;">Lab 12. Bioinformatics Exercises: BLAST & Genomes
==Expected Learning Outcomes==
==Expected Learning Outcomes==
* Be able to perform NCBI BLAST search for homologous sequences in GenBank.
* Be able to perform NCBI BLAST search for homologous sequences in GenBank.
* Be able to identify homologs in other model organisms.
* Be able to identify homologs in other model organisms.
* Be able to identify alternative splice forms a single gene using NCBI web tools
* Be able to identify alternative splice forms a single gene using NCBI web tools
• Be able to analyze locus structure from the information obtained from locus page
* Be able to analyze locus structure from the information obtained from locus page
----
----


Line 46: Line 46:
<li>Sequence identity, number of matched bases, and number of gaps between the matched sequences
<li>Sequence identity, number of matched bases, and number of gaps between the matched sequences
</ol>
</ol>
<li>Click the link for "5' side" (next to '''Features''') will bring you a standard GenBank file of this gene. Locate and write down the
<li>Click "Genome Data Viewer" at top right will bring you to a genome browser
following structural information about this gene in your lab report file:
<li>Mouse-over the central segment and click the link "GenBank View". A standard GenBank file of this gene will load. Locate the 1st "mRNA" feature block and write down the following structural information about this gene in your lab report file:
<ol>
<ol>
<li>Gene accession (ID number)
<li>Gene ID
<li>Total length of the gene
<li>Total length of the gene
<li>Number of introns
<li>Number of introns
Line 64: Line 64:
# Click on "CDS" and notice that coding sequences are now highlighted
# Click on "CDS" and notice that coding sequences are now highlighted
# Fill in '''Table 3''' in your lab report file for each coding sequence you could identify:
# Fill in '''Table 3''' in your lab report file for each coding sequence you could identify:
# DRAW a diagram of this gene based on the above exon and intron coordinates. Use the provided graph paper for this. MAKE SURE to indicate your names+ section # and RETURN IT TO YOUR TA at the end of the session, otherwise you will not get credit for this exercise.
# Obtain the intron/exon gene structure and copy into your lab report file. To do this:
##Label the top of the diagram with basic information, such as the gene's name and species information.
##go back to the Genbank page for AF527840 (as instructed above)
##Label coordinates for introns, exons, 3'/5' UTRs, start-codon, and stop-codon coordinates.
##click on the "Graphics" link
##Draw the diagram mostly to scale. It does NOT have to be perfect, but make a reasonable effort. Put a scale bar and length markers on your drawing.
##you will see a window with a diagram, showing the genomic sequence in green, the primary transcript in purple, and the coding sequence in red
##copy and paste this diagram into your lab report (or create a desktop picture, crop as needed and paste into your lab report file)
# Answer the following questions, in your lab report file:
# Answer the following questions, in your lab report file:
## What is the total length of exons, introns, and coding sequences of this gene?
## What is the total length of exons, introns, and coding sequences of this gene?
Line 109: Line 110:
----
----


==Exercise 3. Alternative splicing: Use BLAST to determine which exons are present in an mRNA==
==Exercise 3. MDM2 homologs in other species==
<center>
This exercise will consist in comparing the predicted protein sequences of MDM2 in three species: human (H. sapiens), mouse (M. musculus) and zebrafish (D. rerio).
<div style="font-family:Monospace;line-height:1;width:800px;border-style:solid;border-width:1px;border-color:#AAAAFF;background-color:#EEEEFF;padding-left:5px;padding-right:5px;padding-top:0px;padding-bottom:0px;">
You will need to download the human MDM2 sequence, find the mouse and fish homologs, and copy each sequence into a MS Word file using the following format:
[[File:4seq.png|800px]]
 
A diagram of the MDM2 gene used in this exercise, along with its splice variants. By the end of this module you will create a similar diagram.
Names (First, Last)
</div>
[Blank line]
</center>
>Human MDM2
You will use the following table for your exercise:
--your amino acid sequence here--
<center>
>Mouse MDM2
{| class="wikitable"
--your amino acid sequence here--
! Genbank Accession # !! cDNA Clone !! Description !! Cell Line !! Length (bp)
  >Zebrafish MDM2
|-
--your amino acid sequence here--
| AF527840 || || Genomic DNA || || 34,088
 
|-
 
| EU076746 || P2-MDM2-C1 || cDNA || MANCA || 427
 
|-
First, you will download the human MDM2 protein sequence. You will then use this sequence as a query to identify the mouse and zebrafish sequences. Follow these steps:
| EU076747 || P2-MDM2-10 || cDNA || ML-1 || 842
 
|-
# Go to this link: https://www.ncbi.nlm.nih.gov/genome/guide/human/
| EU076748 || P2-MDM2-C || cDNA  || A876 || 505
# in the box "search for human genes" type in "MDM2"
|-
# you will see many hits- the top one corresponds to the human MDM2 locus- click on the link
| EU076749 || P2-MDM2-FL || cDNA || SJSA-1 || 845
# This is the human MDM2 locus page- there is much information here. Scroll down to "Genomic regions, transcripts, and products"
|-
# You see here a map of the known transcripts produced for this locus
|}
# now scroll down to "mRNA and Protein(s)"
</center>
# here, find the entry corresponding to the LONGEST isoform
Blast one of the mRNA sequences (EU076746, EU076747, EU076748, EU076749) against the main sequence (AF527840) and use the results to answer the following questions. Suggested procedures:
# for each entry, you will see two identifiers : NM_....  and NP_....
# Go to the [http://www.ncbi.nlm.nih.gov/BLAST/ NCBI BLAST website]
# NM_... corresponds to the mRNA sequence for this isoform, and NP_.... to its predicted protein sequence
# Click the link “Global Align" (one of choices, bottom 1/2 of the page): this allows you to  two (or more) sequences using BLAST (bl2seq)
# click on the link for the protein sequence for the longest isoform, and find the 'FASTA' format
# In the “Sequence 1” text box, type in "EU076748" (or other cDNA accession in the table). In the “Sequence 2” text box, type “AF527840” (the accession for the genomics).
# copy the protein sequence by highlighting all residues from the initial 'M' to the last residue- nothing else
# Click “Align”. You should get a “Blast Result” output page.
# paste the sequence into your word file as instructed above
# Fill in the following table in your lab report file based on BLAST-identified coordinates:
 
<center>
now let's find the mouse homolog using the human sequence as a query:
Table 4. A splice variant of mdm2 (Your choice of mRNA accession:________)
 
{| class="wikitable"
#go to the main NCBI link: https://www.ncbi.nlm.nih.gov
|-
#on the right side, under "Popular resources", click on "Blast"
! Match # !! Query start !! Query end !! Subject start !! Subject end !! Exon # (consult Table 1)
#click on 'mouse' to blast the mouse genome- make sure you use the right tool (blastp) and the correct database (refuses protein)
|-
#in the window, paste in your human MDM2 sequence- this is your query, and click on "BLAST"
| ? || ? || ? || ? || ? || ?
#wait a few minutes... you will see your screen refreshing a few times
|}
#you get a number of hits- scroll down to the best one (under "alignments") and click on "gene" on the right side, under "related information"
</center>
#you are now on the mouse MDM2 locus page: find the protein sequence to the LONGEST isoform and paste into your page as above
----
 
now let us get the Zebrafish homolog:
 
#go to the genome portal : http://zfin.org
#find the protein sequence and paste into your page as above. Make sure you use the right program and database for a protein BLAST!
 
you will now make an alignment of all three sequences to see potential identities or similarities between them
 
#this involves two steps: first, the production of an output file by a program called "Clustal W"
# and second, the processing of this file to generate an alignment figure by a program called "Boxshade"
#go to this link:  http://www.genome.jp/tools-bin/clustalw
#in the top window, paste in your three sequence by selecting from your first ">" sign to the end of your file (do not take your header, with your names)
# click on "multiple alignment"
#you will see an 'aln' output file: select the file including the header on top "CLUSTAL 2.1 multiple sequence alignment" down to the bottom of the file (no extra spaces)- copy in the buffer
#to do the alignment figure, go to :  https://embnet.vital-it.ch/software/BOX_form.html
#there, enter your input sequence format as 'ALN' and in the window below that, paste your aln file
#click on 'run boxshade'
#under results: click on 'boxshade output 1"--- here's your alignment! (this should open with adobe acrobat and might take a bit of time)
#the output is a pdf file-- save it and import into your lab report word file (as page 2) by doing an "Insert--- picture from file" in MS Word- you will have two pages: page 1 with your MDM2 sequences, and page 2 with your alignment
 
 
 


==Group Discussion Questions--NOT PART OF THE LAB REPORT--==
==Group Discussion Questions--NOT PART OF THE LAB REPORT--==
# Explain the following BLAST terms: “Expect” (e-value) [http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=FAQ#expect Read this FAQ], “Identities”, “Gap”, “Strand”.
# Explain the following BLAST terms: “Expect” (e-value) [http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=FAQ#expect Read this FAQ], “Identities”, “Gap”, “Strand”.
# Which is a statistically more significant match by BLAST, a match with an e-value=1e-5 or a match with an e-value of 1?
# Which is a statistically more significant match by BLAST, a match with an e-value=1e-5 or a match with an e-value of 1?
# If you want your match to be biologically relevant (and not random, chance matches), should you use the default e-value cutoff of 10?
# List and describe individual elements of a typical human gene based on mdm2.  
# List and describe individual elements of a typical human gene based on mdm2.  
#what are two determinants that can lead to the production of isoforms for a specific locus?
# What is the "GT-AG" rule? Explain how to read the sequence logos. Explain the significance of sequence conservation at exon-intron junctions.
# What is the "GT-AG" rule? Explain how to read the sequence logos. Explain the significance of sequence conservation at exon-intron junctions.
# Describe biological significance of alternative splicing, using mdm2 gene as an example.
# Discuss biological significance of alternative splicing, using mdm2 gene as an example.
----
#look at your alignment from part III: what are the black boxes- the grey boxes?
#do you see many gaps/insertions?do you think there is a pattern?


==Reference==
* Arva NC, Talbott KE, Okoro DR, Brekman A, Qiu WG, Bargonetti J. 2008. Disruption of the p53-Mdm2 complex by Nutlin-3 reveals different cancer cell phenotypes. Ethnicity and Disease. 18(S2):1-8. [http://www.ncbi.nlm.nih.gov/pubmed/18646312 PubMed Abstract]
----
----

Latest revision as of 19:40, 1 May 2019

Lab 12. Bioinformatics Exercises: BLAST & Genomes

Expected Learning Outcomes

  • Be able to perform NCBI BLAST search for homologous sequences in GenBank.
  • Be able to identify homologs in other model organisms.
  • Be able to identify alternative splice forms a single gene using NCBI web tools
  • Be able to analyze locus structure from the information obtained from locus page

Lab Report III

  1. The lab report is worth 50 points. There is one lab report per group of 2 students
  2. You have to complete the lab report by completing the lab report template on your lab terminal.
  3. Name your file as follows: LAST name 1-LAST name 2- section # (e.g.: Smith-Miller- L01).
  4. you need to EMAIL your file at the end of the session (TODAY) to your T.A. to get credit for your work.

Introduction

Research in molecular genetics requires effective use of online bioinformatic tools to analyze and understand the genetic materials being worked with. The following exercises will expose you to real-world scenarios and introduce you to the methods and tools you can use to solve these problems.

In biology, homology is defined as a common or shared evolutionary origin. Therefore, homologous sequences are sequences diverged from a common ancestor. Note that the word "homology" is different from "similarity": homologous structures or sequences may not be similar (e.g., forearms in mammals and birds) and, conversely, similar structures or sequences may not be homologous (e.g., wings in birds and bats).

BLAST is a computer algorithm allowing for efficient search of similar sequences in a large database. While BLAST performs a similar function to Google search, you should not use Google to look for similar sequences in a human or other genome. When sequences are similar with a sufficient statistical significance (measured by e-value, see below), we consider these sequences homologous to each other.


Exercise 1. Homology searching using BLAST

  1. Go to the NCBI-BLAST website at NCBI/BLAST Home Page
  2. To know more about BLAST, read the expanded answer by clicking on "Learn more"
  3. Since BLAST finds matches between nucleotide or protein sequences, it needs a "query" sequence as input as well as a "database" to search against. Make sure to know what your "query" sequence is and find the appropriate "database".
  4. Start BLASTing against the mouse genome by clicking "Mouse" under "BLAST Genomes"
  5. Copy and paste the following sequence into the "Enter Query Sequence" box:

CTAGATGCATTTACGAAGGAGACAGAAAACGTCTTTCGGCAATAGCTCTCAAATGCAAAACGACGTCGG CGAGCTGTCCCTTACCTGGAGGCCCGCAGGAGAAGCGCGGTGATCCGAGAGGGTCCCCCAGGGGTGTCCG GTCGGTCTCCCGCTCGCCCAGCAGACGGCTGCGGAAACGGGGCAGCGTTTAAATAACCCCAGCTGGAGAC ATGTCAGGACTTAGCTCCTCCGACAGCCGACGCCGGACGTGTCCCAACTTGACCAGCCCCACAGGAAGAG CTGAGTCAACTCGGCCCAGCCCAGTCCCACCCGTCCCGGAAGCCGCATCCCGGCGAGTCCGGGACCAGGC ACCTGTCACCTCCTGGACCCCAGCAACGAGCCCAGCGCGACCCCGGAGCGGGCCCGAATTCT

  1. Scroll down to the bottom of the page and click "BLAST"
  2. Wait for 10-30 seconds for the results to return (be patient). Once the result page is loaded, locate and copy/write down the following information in your lab report file for the first hit:
    1. Species and strain
    2. Chromosome
    3. Length of your query sequence
    4. Sequence identity, number of matched bases, and number of gaps between the matched sequences
  3. Click "Genome Data Viewer" at top right will bring you to a genome browser
  4. Mouse-over the central segment and click the link "GenBank View". A standard GenBank file of this gene will load. Locate the 1st "mRNA" feature block and write down the following structural information about this gene in your lab report file:
    1. Gene ID
    2. Total length of the gene
    3. Number of introns
    4. Which is the non-template (mRNA analog) strand: the above sequence itself or its reverse complement? [Hint: note the word complement in mRNA and cDNA lines)

Exercise 2. Explore the structure of human mdm2 gene

  1. Search GenBank using the accession AF527840. Read the GenBank file and find out from the feature table how many introns and exons this sequence has according to the "mRNA" and "CDS" features.
  2. Click on "mRNA" and notice that exon sequences are now highlighted
  3. Fill in Table 1 in your lab report file for each EXON you could identify:
  4. Fill in Table 2 in your lab report file for each INTRON you could identify:
  5. Click on "CDS" and notice that coding sequences are now highlighted
  6. Fill in Table 3 in your lab report file for each coding sequence you could identify:
  7. Obtain the intron/exon gene structure and copy into your lab report file. To do this:
    1. go back to the Genbank page for AF527840 (as instructed above)
    2. click on the "Graphics" link
    3. you will see a window with a diagram, showing the genomic sequence in green, the primary transcript in purple, and the coding sequence in red
    4. copy and paste this diagram into your lab report (or create a desktop picture, crop as needed and paste into your lab report file)
  8. Answer the following questions, in your lab report file:
    1. What is the total length of exons, introns, and coding sequences of this gene?
    2. Are all exon sequences code for proteins? Which exons are non-coding in mdm2?
    3. Align the first 5 bases of all introns. Which bases are conserved near intron start ("donor site")?
    4. Align the last 5 bases of all introns. Which bases are conserved near intron end ("acceptor site")?
    5. Using WebLogo and make a sequence logo for the acceptor site and another sequence logo for the donor site. To do so, copy & paste individual sequences at the acceptor site into this text box and click "Create Logo". Save the resulting image file and paste it into your lab report file. Repeat for the donor-site sequences.

Table 1. mdm2 Exons

Exon # Start Position End Position Length
#1 1971 2271 301
#2 ? ? ?

Table 2. mdm2 Introns

Intro Number Start Position End Position Length First 5 bases Last 5 bases Phase*
#1 2272 2987 616 GTACT TGTAG ?
#2 ? ? ? ? ? ?
  • Introns have phases. Phase 0 introns sit between 2 codons, phase 1 intron sit between the 1st codon position and the 2nd codon position, and phase 3 introns sit between the 2nd and 3rd codon position. How would you find out the phase of an intron? [Hint, use Table 3 CDS positions below].

Table 3. mdm2 Coding Sequences (CDS)

CDS # Start Position End Position Length
#1 2992 3072 81
#2 ? ? ?

Exercise 3. MDM2 homologs in other species

This exercise will consist in comparing the predicted protein sequences of MDM2 in three species: human (H. sapiens), mouse (M. musculus) and zebrafish (D. rerio). You will need to download the human MDM2 sequence, find the mouse and fish homologs, and copy each sequence into a MS Word file using the following format:

Names (First, Last)
[Blank line]
>Human MDM2
--your amino acid sequence here--
>Mouse MDM2
--your amino acid sequence here--
>Zebrafish MDM2
--your amino acid sequence here--


First, you will download the human MDM2 protein sequence. You will then use this sequence as a query to identify the mouse and zebrafish sequences. Follow these steps:

  1. Go to this link: https://www.ncbi.nlm.nih.gov/genome/guide/human/
  2. in the box "search for human genes" type in "MDM2"
  3. you will see many hits- the top one corresponds to the human MDM2 locus- click on the link
  4. This is the human MDM2 locus page- there is much information here. Scroll down to "Genomic regions, transcripts, and products"
  5. You see here a map of the known transcripts produced for this locus
  6. now scroll down to "mRNA and Protein(s)"
  7. here, find the entry corresponding to the LONGEST isoform
  8. for each entry, you will see two identifiers : NM_.... and NP_....
  9. NM_... corresponds to the mRNA sequence for this isoform, and NP_.... to its predicted protein sequence
  10. click on the link for the protein sequence for the longest isoform, and find the 'FASTA' format
  11. copy the protein sequence by highlighting all residues from the initial 'M' to the last residue- nothing else
  12. paste the sequence into your word file as instructed above

now let's find the mouse homolog using the human sequence as a query:

  1. go to the main NCBI link: https://www.ncbi.nlm.nih.gov
  2. on the right side, under "Popular resources", click on "Blast"
  3. click on 'mouse' to blast the mouse genome- make sure you use the right tool (blastp) and the correct database (refuses protein)
  4. in the window, paste in your human MDM2 sequence- this is your query, and click on "BLAST"
  5. wait a few minutes... you will see your screen refreshing a few times
  6. you get a number of hits- scroll down to the best one (under "alignments") and click on "gene" on the right side, under "related information"
  7. you are now on the mouse MDM2 locus page: find the protein sequence to the LONGEST isoform and paste into your page as above

now let us get the Zebrafish homolog:

  1. go to the genome portal : http://zfin.org
  2. find the protein sequence and paste into your page as above. Make sure you use the right program and database for a protein BLAST!

you will now make an alignment of all three sequences to see potential identities or similarities between them

  1. this involves two steps: first, the production of an output file by a program called "Clustal W"
  2. and second, the processing of this file to generate an alignment figure by a program called "Boxshade"
  3. go to this link: http://www.genome.jp/tools-bin/clustalw
  4. in the top window, paste in your three sequence by selecting from your first ">" sign to the end of your file (do not take your header, with your names)
  5. click on "multiple alignment"
  6. you will see an 'aln' output file: select the file including the header on top "CLUSTAL 2.1 multiple sequence alignment" down to the bottom of the file (no extra spaces)- copy in the buffer
  7. to do the alignment figure, go to : https://embnet.vital-it.ch/software/BOX_form.html
  8. there, enter your input sequence format as 'ALN' and in the window below that, paste your aln file
  9. click on 'run boxshade'
  10. under results: click on 'boxshade output 1"--- here's your alignment! (this should open with adobe acrobat and might take a bit of time)
  11. the output is a pdf file-- save it and import into your lab report word file (as page 2) by doing an "Insert--- picture from file" in MS Word- you will have two pages: page 1 with your MDM2 sequences, and page 2 with your alignment



Group Discussion Questions--NOT PART OF THE LAB REPORT--

  1. Explain the following BLAST terms: “Expect” (e-value) Read this FAQ, “Identities”, “Gap”, “Strand”.
  2. Which is a statistically more significant match by BLAST, a match with an e-value=1e-5 or a match with an e-value of 1?
  3. List and describe individual elements of a typical human gene based on mdm2.
  4. what are two determinants that can lead to the production of isoforms for a specific locus?
  5. What is the "GT-AG" rule? Explain how to read the sequence logos. Explain the significance of sequence conservation at exon-intron junctions.
  6. Discuss biological significance of alternative splicing, using mdm2 gene as an example.
  7. look at your alignment from part III: what are the black boxes- the grey boxes?
  8. do you see many gaps/insertions?do you think there is a pattern?