QuBi/modules/biol302: Difference between revisions

From QiuLab
Jump to navigation Jump to search
imported>Ppagan
No edit summary
imported>Weigang
 
(101 intermediate revisions by 2 users not shown)
Line 1: Line 1:
=BIOL 302 Lab (Bioinformatics Exercises)=
; <div style="font-size:180%">BIOL 302 Lab (Bioinformatics Exercises)</div>
[[NOTE: Link to BIOL302 page, if one exists]]
----
 
Research in molecular genetics requires effective use of bioinformatic tools to analyze and understand the genetic materials being worked with. The following exercises will expose you to real-world scenarios and introduce you to the methods and tools you can use to solve these problems.   
Research in molecular genetics requires effective use of bioinformatic tools to analyze and understand the genetic materials being worked with. The following exercises will expose you to real-world scenarios and introduce you to the methods and tools you can use to solve these problems.   


==[[QuBi/modules/biol302#MODULE: Cloning of murine mdm2 gene sequence to study cis-acting DNA elements|Part 1: Cloning of murine mdm2 gene sequence to study cis acting DNA elements]]==
===[[QuBi/modules/biol302#Key Concepts2|Key Concepts]]===
*Homology searching using BLAST ('''not Google''')
*Mammalian gene regulation
So far, you have excised this XbaI fragment:
<div style="font-family:Monospace;line-height:1;width:550px;border-style:solid;border-width:1px;border-color:#AAAAFF;background-color:#EEEEFF;padding-left:5px;padding-right:5px;padding-top:0px;padding-bottom:0px;">
CTAGATGCATTTACGAAGGAGACAGAAAACGTCTTTCGGCAATAGCTCTCAAATGCAAAACGACGTCGG
CGAGCTGTCCCTTACCTGGAGGCCCGCAGGAGAAGCGCGGTGATCCGAGAGGGTCCCCCAGGGGTGTCCG
GTCGGTCTCCCGCTCGCCCAGCAGACGGCTGCGGAAACGGGGCAGCGTTTAAATAACCCCAGCTGGAGAC
ATGTCAGGACTTAGCTCCTCCGACAGCCGACGCCGGACGTGTCCCAACTTGACCAGCCCCACAGGAAGAG
CTGAGTCAACTCGGCCCAGCCCAGTCCCACCCGTCCCGGAAGCCGCATCCCGGCGAGTCCGGGACCAGGC
ACCTGTCACCTCCTGGACCCCAGCAACGAGCCCAGCGCGACCCCGGAGCGGGCCCGAATTCT
</div>
----
===Gene identification using genome BLAST===
# Go to the NCBI-BLAST website at [http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome NCBI/BLAST Home Page]
# What is BLAST? Find the expanded answer by clicking on "more"
# Since BLAST finds matches (homologous sequences) between biological sciences, it needs a "query" sequence as input as well as a "database" to search against. To find the matches to the above sequence, what would be your "query" sequence and what would be your "database"?
# Start BLASTing against the mouse genome by clicking "Mouse" under "BLAST Assembled RefSeq Genomes"
# Copy and paste the above sequence into the "Enter Query Sequence" box
# Scroll down to the bottom of the page and click "BLAST"
# Wait for 10-30 seconds for the results to return ('''Be Patient'''). Once the result page is loaded, locate and copy/write down the following information:
## Species and strain
## Chromosome
## Length of your query sequence
## Sequence identity, number of matched bases, and number of gaps between the matched sequences
# Click the link for "5' side" (next to '''Features''') will bring you a standard GenBank file of this gene. Locate and copy the following structural information about this gene:
## Gene accession (ID number)
## Total length of the gene
## Number of introns
## Which is the non-template (mRNA analog) strand: the above sequence itself or its reverse complement? [Hint: note the word '''complement''' in mRNA and cDNA lines)
----


==Identification of mdm2 Splice Variants Using BLAST==
===Explore pGL2 vector===
===[[QuBi/modules/biol302#Objectives|Objectives]]===
This sequence has been cloned into the NheI site in the pGL2basic vector:
* Learn to use Genbank database and BLAST tool to analyze nucleotide sequences
<div style="font-family:Monospace;line-height:1;width:400px;border-style:solid;border-width:1px;border-color:#AAAAFF;background-color:#EEEEFF;padding-left:5px;padding-right:5px;padding-top:0px;padding-bottom:10px;">
* Use BLAST to identify
[[File:PGL2vector-map.png|400px]]
''[http://www.promega.com/~/media/Files/Resources/Protocols/Technical%20Manuals/0/pGL2%20Luciferase%20Reporter%20Vectors%20Protocol.pdf Source: Promega]''
</div>
# Identify the location where you have cloned your fragment
# What are the two possible directions (with respect to the luciferase gene) you may have cloned your fragment?
# From the PDF file, find the location of the EcoRI site
----


===[[QuBi/modules/biol302#Key Concepts|Key Concepts]]===
===Identify regulatory elements through literature search===
====Blast====
====Alternative Splicing====


<div style="font-family:Monospace;line-height:1;width:800px;border-style:solid;border-width:1px;border-color:#AAAAFF;background-color:#EEEEFF;padding-left:5px;padding-right:5px;padding-top:0px;padding-bottom:0px;">
[[File:Zauberman_fig2.png|800px]]


===[[QuBi/modules/biol302#Exercise|Exercise]]===
''Source:'' Zauberman et al. "A functional p53-responsive intronic promoter is contained within the human mdm2 gene". Nucleic Acids Res. 1995 July 25; 23(14): 2584–2592. ''[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC307078/ Pubmed] [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC307078/pdf/nar00014-0022.pdf PDF]''
</div>
----
# Identify the TATA box in the above sequence by looking for AT-rich regions
# Once the TATA box is located, use this sequence as the anchor point to locate other elements, including the two p53 Response Element (p53 RE) sites and the Exon 2
# Locate the EcoRI restriction site using the [http://tools.neb.com/NEBcutter2/ NEBcutter website]
# What are the expected EcoRI fragment sizes for the two possible orientations of your cloned DNA?
# Which orientation would you expect to give higher luciferase expression?


[[NOTE: Maybe we should remove the "Description" section of this table and leave it up to the students to figure out which exons are missing]]
----
 
==[[QuBi/modules/biol302#Part 2: Identification of mdm2 Splice Variants Using BLAST|Part 2 (Extra Credit Assignment): Identification of mdm2 Splice Variants Using BLAST]]==
<div style="font-family:Monospace;line-height:1;width:800px;border-style:solid;border-width:1px;border-color:#AAAAFF;background-color:#EEEEFF;padding-left:5px;padding-right:5px;padding-top:0px;padding-bottom:0px;">
[[File:4seq.png|800px]]
 
A diagram of the MDM2 gene used in this exercise, along with its splice variants. By the end of this module you will create a similar diagram. ''Reference:'' Arva NC, Talbott KE, Okoro DR, Brekman A, Qiu WG, Bargonetti J. 2008. Disruption of the p53-Mdm2 complex by Nutlin-3 reveals different cancer cell phenotypes. Ethnicity and Disease. 18(S2):1-8.
</div>
----
===[[QuBi/modules/biol302#Objectives|Key Concepts]]===
* Use BLAST ('''not Google''') to find matches of DNA and protein sequences
* Alternative splicing and isoforms of a single gene
You will use the following table for your exercise:
{| class="wikitable"
{| class="wikitable"
! Genbank Accession # !! cDNA Clone !! Description !! Cell Line !! Length (bp)
! Genbank Accession # !! cDNA Clone !! Description !! Cell Line !! Length (bp)
Line 22: Line 83:
| AF527840 || || Genomic DNA || || 34,088
| AF527840 || || Genomic DNA || || 34,088
|-
|-
| EU076746 || P2-MDM2-C1 || cDNA missing exons 5-9 & 11 || MANCA || 427
| EU076746 || P2-MDM2-C1 || cDNA  || MANCA || 427
|-
|-
| EU076747 || P2-MDM2-10 || cDNA missing exon 10 || ML-1 || 842
| EU076747 || P2-MDM2-10 || cDNA || ML-1 || 842
|-
|-
| EU076748 || P2-MDM2-C  || cDNA missing exons 5-9 || A876 || 505
| EU076748 || P2-MDM2-C  || cDNA  || A876 || 505
|-
|-
| EU076749 || P2-MDM2-FL || Full-length cDNA || SJSA-1 || 845
| EU076749 || P2-MDM2-FL || cDNA || SJSA-1 || 845
|-
|-
|}
|}


; Explore the annotation for AF527840.  
----
The sequences on the genbank database have annotations associated with them. Some sequences are richly annotated to contain all of the details you would want, and other sequences may have almost no annotations at all. The sequence you are about to explore is well annotated with details such as exon locations and nucleotide variablility. Use the annotations to complete the following tasks and questions.
===Explore the GenBank file===
 
#Search [http://www.ncbi.nlm.nih.gov/sites/entrez?db=Nucleotide GenBank] using the accession AF527840. Read the GenBank file and find out from the feature table how many introns and exons this sequence has according to the "mRNA" and "CDS" features.  
1) DRAW a diagram of this gene, including its introns/exons, 3'/5' UTRs, +1. (Note: this diagram is going to be very handy for the last set of questions.)
# DRAW a diagram of this gene using the information and coordinates listed in the annotation.  
- Label each feature with its coordinates. For example, if an exon starts at 500bp and ends at 1000bp, label it as such.
##Label the top of the diagram with basic information, such as the gene's name and species information.
- Label the diagram with basic information, such as the gene's name and th organism's species.
##Label coordinates for introns, exons, 3'/5' UTRs,start-codon, and stop-codon coordinates.
- The drawing does not have to be exactly to scale, a reasonable effort should be made to do so. Put length markers on your drawing (for example, every 5000bp.)
##Draw the diagram mostly to scale. It does NOT have to be perfect, but make a reasonable effort. Put a scale bar and length markers on your drawing.
- The mRNA annotation states which segments are used to create mRNA, and the CDS annotation states which parts actully code amino acids (CDS = coding sequence).
----
 
===Explore the graphical presentation of the gene===
2) How does the sequence vary at positions X, X, and X for this gene?
Genbank provides graphical representations of the sequences on its database: click the "Graphics" link below the sequence title, OR click "Display Settings" above the title, and choose "Graphics". Take a few minutes to explore this graphical and compare it with your diagram.
 
----
3) What kinds of repeat regions can be found in this gene?
===Use BLAST to determine which exons are used in the mRNA transcript===
 
This is the most "bioinformatic" part of the assignment. Blast one of the mRNA sequences (EU076746, EU076747, EU076748, EU076749) against the main sequence (AF527840) and use the results to answer the following questions. Suggested procedures:
[[File:4seq.png]]
# Go to the [http://www.ncbi.nlm.nih.gov/BLAST/ NCBI BLAST] website
 
# Click the link “Align two (or more) sequences using BLAST (bl2seq)” under “Specialized BLAST” (near the page bottom)
===[[QuBi/modules/biol302#Exit_Questions|Exit Questions]]===
# In the “Sequence 1” text box, type “AF527840” (the accession for the genomics).  Fill in “from 1” and “to 34088”. In the “Sequence 2” text box, type in "EU076748" (or other cDNA accession in the table). Fill in the “from” box with 1 and the “to” box with 505.
# Click “Align”.  You should get a “Blast Result” output page.
# Interpret your results:
## Which exons are present and which ones are absent in EU076746, EU076747, EU076748, EU076749? (Hint: Refer to the mRNA join statement).
## Explain the following BLAST terms: “Expect” (e-value), “Identities”, “Gap”, “Strand”
----

Latest revision as of 14:50, 23 March 2013

BIOL 302 Lab (Bioinformatics Exercises)

Research in molecular genetics requires effective use of bioinformatic tools to analyze and understand the genetic materials being worked with. The following exercises will expose you to real-world scenarios and introduce you to the methods and tools you can use to solve these problems.

Part 1: Cloning of murine mdm2 gene sequence to study cis acting DNA elements

Key Concepts

  • Homology searching using BLAST (not Google)
  • Mammalian gene regulation

So far, you have excised this XbaI fragment:

CTAGATGCATTTACGAAGGAGACAGAAAACGTCTTTCGGCAATAGCTCTCAAATGCAAAACGACGTCGG CGAGCTGTCCCTTACCTGGAGGCCCGCAGGAGAAGCGCGGTGATCCGAGAGGGTCCCCCAGGGGTGTCCG GTCGGTCTCCCGCTCGCCCAGCAGACGGCTGCGGAAACGGGGCAGCGTTTAAATAACCCCAGCTGGAGAC ATGTCAGGACTTAGCTCCTCCGACAGCCGACGCCGGACGTGTCCCAACTTGACCAGCCCCACAGGAAGAG CTGAGTCAACTCGGCCCAGCCCAGTCCCACCCGTCCCGGAAGCCGCATCCCGGCGAGTCCGGGACCAGGC ACCTGTCACCTCCTGGACCCCAGCAACGAGCCCAGCGCGACCCCGGAGCGGGCCCGAATTCT


Gene identification using genome BLAST

  1. Go to the NCBI-BLAST website at NCBI/BLAST Home Page
  2. What is BLAST? Find the expanded answer by clicking on "more"
  3. Since BLAST finds matches (homologous sequences) between biological sciences, it needs a "query" sequence as input as well as a "database" to search against. To find the matches to the above sequence, what would be your "query" sequence and what would be your "database"?
  4. Start BLASTing against the mouse genome by clicking "Mouse" under "BLAST Assembled RefSeq Genomes"
  5. Copy and paste the above sequence into the "Enter Query Sequence" box
  6. Scroll down to the bottom of the page and click "BLAST"
  7. Wait for 10-30 seconds for the results to return (Be Patient). Once the result page is loaded, locate and copy/write down the following information:
    1. Species and strain
    2. Chromosome
    3. Length of your query sequence
    4. Sequence identity, number of matched bases, and number of gaps between the matched sequences
  8. Click the link for "5' side" (next to Features) will bring you a standard GenBank file of this gene. Locate and copy the following structural information about this gene:
    1. Gene accession (ID number)
    2. Total length of the gene
    3. Number of introns
    4. Which is the non-template (mRNA analog) strand: the above sequence itself or its reverse complement? [Hint: note the word complement in mRNA and cDNA lines)

Explore pGL2 vector

This sequence has been cloned into the NheI site in the pGL2basic vector:

PGL2vector-map.png Source: Promega

  1. Identify the location where you have cloned your fragment
  2. What are the two possible directions (with respect to the luciferase gene) you may have cloned your fragment?
  3. From the PDF file, find the location of the EcoRI site

Identify regulatory elements through literature search

Zauberman fig2.png

Source: Zauberman et al. "A functional p53-responsive intronic promoter is contained within the human mdm2 gene". Nucleic Acids Res. 1995 July 25; 23(14): 2584–2592. Pubmed PDF


  1. Identify the TATA box in the above sequence by looking for AT-rich regions
  2. Once the TATA box is located, use this sequence as the anchor point to locate other elements, including the two p53 Response Element (p53 RE) sites and the Exon 2
  3. Locate the EcoRI restriction site using the NEBcutter website
  4. What are the expected EcoRI fragment sizes for the two possible orientations of your cloned DNA?
  5. Which orientation would you expect to give higher luciferase expression?

Part 2 (Extra Credit Assignment): Identification of mdm2 Splice Variants Using BLAST

4seq.png

A diagram of the MDM2 gene used in this exercise, along with its splice variants. By the end of this module you will create a similar diagram. Reference: Arva NC, Talbott KE, Okoro DR, Brekman A, Qiu WG, Bargonetti J. 2008. Disruption of the p53-Mdm2 complex by Nutlin-3 reveals different cancer cell phenotypes. Ethnicity and Disease. 18(S2):1-8.


Key Concepts

  • Use BLAST (not Google) to find matches of DNA and protein sequences
  • Alternative splicing and isoforms of a single gene

You will use the following table for your exercise:

Genbank Accession # cDNA Clone Description Cell Line Length (bp)
AF527840 Genomic DNA 34,088
EU076746 P2-MDM2-C1 cDNA MANCA 427
EU076747 P2-MDM2-10 cDNA ML-1 842
EU076748 P2-MDM2-C cDNA A876 505
EU076749 P2-MDM2-FL cDNA SJSA-1 845

Explore the GenBank file

  1. Search GenBank using the accession AF527840. Read the GenBank file and find out from the feature table how many introns and exons this sequence has according to the "mRNA" and "CDS" features.
  2. DRAW a diagram of this gene using the information and coordinates listed in the annotation.
    1. Label the top of the diagram with basic information, such as the gene's name and species information.
    2. Label coordinates for introns, exons, 3'/5' UTRs,start-codon, and stop-codon coordinates.
    3. Draw the diagram mostly to scale. It does NOT have to be perfect, but make a reasonable effort. Put a scale bar and length markers on your drawing.

Explore the graphical presentation of the gene

Genbank provides graphical representations of the sequences on its database: click the "Graphics" link below the sequence title, OR click "Display Settings" above the title, and choose "Graphics". Take a few minutes to explore this graphical and compare it with your diagram.


Use BLAST to determine which exons are used in the mRNA transcript

This is the most "bioinformatic" part of the assignment. Blast one of the mRNA sequences (EU076746, EU076747, EU076748, EU076749) against the main sequence (AF527840) and use the results to answer the following questions. Suggested procedures:

  1. Go to the NCBI BLAST website
  2. Click the link “Align two (or more) sequences using BLAST (bl2seq)” under “Specialized BLAST” (near the page bottom)
  3. In the “Sequence 1” text box, type “AF527840” (the accession for the genomics). Fill in “from 1” and “to 34088”. In the “Sequence 2” text box, type in "EU076748" (or other cDNA accession in the table). Fill in the “from” box with 1 and the “to” box with 505.
  4. Click “Align”. You should get a “Blast Result” output page.
  5. Interpret your results:
    1. Which exons are present and which ones are absent in EU076746, EU076747, EU076748, EU076749? (Hint: Refer to the mRNA join statement).
    2. Explain the following BLAST terms: “Expect” (e-value), “Identities”, “Gap”, “Strand”