QuBi/modules/biol302: Difference between revisions

From QiuLab
Jump to navigation Jump to search
imported>Ppagan
No edit summary
imported>Ppagan
No edit summary
Line 1: Line 1:
; <span style="font-size:180%">BIOL 302 Lab (Bioinformatics Exercises)</span>
; <div style="font-size:180%">BIOL 302 Lab (Bioinformatics Exercises)</div>
----
----
Research in molecular genetics requires effective use of bioinformatic tools to analyze and understand the genetic materials being worked with. The following exercises will expose you to real-world scenarios and introduce you to the methods and tools you can use to solve these problems.   
Research in molecular genetics requires effective use of bioinformatic tools to analyze and understand the genetic materials being worked with. The following exercises will expose you to real-world scenarios and introduce you to the methods and tools you can use to solve these problems.   
Line 87: Line 87:
You will do this by cloning this fragment:
You will do this by cloning this fragment:


<pre>TCTAGATGCATTTACGAAGGAGACAGAAAACGTCTTTCGGCAATAGCTCTCAAATGCAAAACGACGTCGGCGAGCTGTCC
<div style="font-family:Monospace;width:800px;">
TCTAGATGCATTTACGAAGGAGACAGAAAACGTCTTTCGGCAATAGCTCTCAAATGCAAAACGACGTCGGCGAGCTGTCC
CTTACCTGGAGGCCCGCAGGAGAAGCGCGGTGATCCGAGAGGGTCCCCCAGGGGTGTCCGGTCGGTCTCCCGCTCGCCCA
CTTACCTGGAGGCCCGCAGGAGAAGCGCGGTGATCCGAGAGGGTCCCCCAGGGGTGTCCGGTCGGTCTCCCGCTCGCCCA
GCAGACGGCTGCGGAAACGGGGCAGCGTTTAAATAACCCCAGCTGGAGACATGTCAGGACTTAGCTCCTCCGACAGCCGA
GCAGACGGCTGCGGAAACGGGGCAGCGTTTAAATAACCCCAGCTGGAGACATGTCAGGACTTAGCTCCTCCGACAGCCGA
CGCCGGACGTGTCCCAACTTGACCAGCCCCACAGGAAGAGCTGAGTCAACTCGGCCCAGCCCAGTCCCACCCGTCCCGGA
CGCCGGACGTGTCCCAACTTGACCAGCCCCACAGGAAGAGCTGAGTCAACTCGGCCCAGCCCAGTCCCACCCGTCCCGGA
AGCCGCATCCCGGCGAGTCCGGGACCAGGCACCTGTCACCTCCTGGACCCCAGCAACGAGCCCAGCGCGACCCCGGAGCG
AGCCGCATCCCGGCGAGTCCGGGACCAGGCACCTGTCACCTCCTGGACCCCAGCAACGAGCCCAGCGCGACCCCGGAGCG
GGCCCGAATTCTCTAGA</pre>
GGCCCGAATTCTCTAGA
</div>


Into this [[vector]]:
Into this [[vector]]:
[[File:PGL2 basic.png|800px]‎]
 
[[File:PGL2_basic.png]]
 
''[http://www.promega.com/products/reporter-assays-and-transfection/reporter-vectors-and-cell-lines/pgl2-luciferase-reporter-vectors/ pGL2 Luciferase Reporter Vectors]''
''[http://www.promega.com/products/reporter-assays-and-transfection/reporter-vectors-and-cell-lines/pgl2-luciferase-reporter-vectors/ pGL2 Luciferase Reporter Vectors]''

Revision as of 21:24, 21 February 2013

BIOL 302 Lab (Bioinformatics Exercises)

Research in molecular genetics requires effective use of bioinformatic tools to analyze and understand the genetic materials being worked with. The following exercises will expose you to real-world scenarios and introduce you to the methods and tools you can use to solve these problems.

MODULE: Identification of mdm2 Splice Variants Using BLAST

4seq.png

A diagram of the MDM2 gene used in this exercise, along with its splice variants. By the end of this module you will create a similar diagram.

Objectives

  • Learn to use Genbank database and BLAST tool to analyze nucleotide sequences
  • Use BLAST to identify

Key Concepts

Blast
Genbank
Annotation
Accession Number
Alternative Splicing

Exercise

Genbank Accession # cDNA Clone Description Cell Line Length (bp)
AF527840 Genomic DNA 34,088
EU076746 P2-MDM2-C1 cDNA missing exons 5-9 & 11 MANCA 427
EU076747 P2-MDM2-10 cDNA missing exon 10 ML-1 842
EU076748 P2-MDM2-C cDNA missing exons 5-9 A876 505
EU076749 P2-MDM2-FL Full-length cDNA SJSA-1 845

Explore the gene annotation for AF527840.

Sequences on genbank have both basic reference information (such as what the sequence is, what organism it came from, and bibliographical information) and sequence annotations. Some sequences are more richly annotated than others - it is up to researchers to annotate the sequences they generate, which requires extra work. For this exercise you will be working will a well-annotated sequence: accession number AF527840. Explore its annotation and use it to complete the following set of tasks.

  1. DRAW a diagram of this gene using the information and coordinates listed in the annotation. (Note: this is the bulk of the assignment and this diagram is needed for the last set of questions. Don't get lazy on this.)
    1. Label the top of the diagram with basic information, such as the gene's name, organism, etc.. Someone should be able to pick up your diagram and know exactly what they're looking at.
    2. Including introns, exons, 3'/5' UTRs, +1, and exact coordinates. (The mRNA annotation states which segments are used to create mRNA, and the CDS annotation states which parts code amino acids (CDS = coding sequence)).
    3. Draw the diagram mostly to scale. It does NOT have to be perfect, but make a reasonable effort. Put a scale bar and length markers on your drawing.
  2. How does the sequence vary at positions X, X, and X for this gene? Do these change the AA for the resulting peptide?
  3. What kinds of repeat regions can be found in this gene?

Explore the graphical presentation of the gene to answer the following question.

Genbank provides graphical representations of the sequences on its database: click the "Graphics" link below the sequence title, OR click "Display Settings" above the title, and choose "Graphics". Take a few minutes to explore this graphical browser and answer the following question:

  1. A question that can only be answered from looking at this graph.
  2. Another question that can only be answered from looking at this graph.

Use BLAST to determine which exons are used in the mRNA transcripts.

This is the most "bioinformatic" part of the assignment. Blast ALL FOUR of the mRNA sequences (EU076746, EU076747, EU076748, EU076749) against the main sequence (AF527840) and use the results to answer the following questions. If you labeled your diagram well (with coordinates!), this task should go by quickly.

  1. Which exons are used to create EU076746, EU076747, EU076748, EU076749?
  2. Do the BLAST search results corresponding to exons exactly match the start/end positions of the exons as labeled in your diagram? If not, what is the most likely reason for this?
  3. Do any of the BLAST results match regions outside of exons? If so, what regions?

Exit Questions

MODULE: Cloning of murine mdm2 gene sequence to study cis acting DNA elements

The students are given the DNA sequence of a fragment they are going to clone into a PGL2 basic vector. You are about

Key Concepts

  • Clone
  • Vector
  • Rotational Symmetry

Exercise

Zauberman fig2.png

PROPERLY CITE THIS Taken from A functional p53-responsive intronic promoter is contained within the human mdm2 gene. Pubmed PDF

SUMMARY OF TASK.......................

You will do this by cloning this fragment:

TCTAGATGCATTTACGAAGGAGACAGAAAACGTCTTTCGGCAATAGCTCTCAAATGCAAAACGACGTCGGCGAGCTGTCC CTTACCTGGAGGCCCGCAGGAGAAGCGCGGTGATCCGAGAGGGTCCCCCAGGGGTGTCCGGTCGGTCTCCCGCTCGCCCA GCAGACGGCTGCGGAAACGGGGCAGCGTTTAAATAACCCCAGCTGGAGACATGTCAGGACTTAGCTCCTCCGACAGCCGA CGCCGGACGTGTCCCAACTTGACCAGCCCCACAGGAAGAGCTGAGTCAACTCGGCCCAGCCCAGTCCCACCCGTCCCGGA AGCCGCATCCCGGCGAGTCCGGGACCAGGCACCTGTCACCTCCTGGACCCCAGCAACGAGCCCAGCGCGACCCCGGAGCG GGCCCGAATTCTCTAGA

Into this vector:

PGL2 basic.png

pGL2 Luciferase Reporter Vectors