Qiu Lab Meetings: Difference between revisions
Jump to navigation
Jump to search
imported>Weigang |
imported>Weigang mNo edit summary |
||
| Line 42: | Line 42: | ||
** Linux Workstations | ** Linux Workstations | ||
---- | ---- | ||
==Perl Challenges== | |||
{| class="wikitable" | |||
! Problem | |||
! Input | |||
! Output | |||
|- | |||
| DNA transcription | |||
| A DNA sequence, in 5'-3' direction (e.g., aaatttaaaagacaaaaagactgctctaagtcttgaaaatttggttttcaaagatgat) | |||
| An RNA sequence, in 5'-3' direction | |||
|- | |||
| Genetic code | |||
| None | |||
| 64 codons, one per line (using loops) | |||
|- | |||
| Random sequence 1 | |||
| None | |||
| Generate a random DNA sequence (e.g., 1000 bases) with equal base frequencies | |||
|- | |||
| Random sequence 2 | |||
| None | |||
| Generate a random DNA sequence with biased base frequencies, e.g., 10% G, 10% C, 40% T, and 40% A. | |||
|- | |||
| Graphics I | |||
| a categorical dataset, e.g., Biology | |||
| a bar graph & a pie char, using GD::Simple or Postscript::Simple | |||
|} | |||
Revision as of 23:53, 15 May 2013
Projects & Goals
- Borrelia population genomics: Recombination & Natural Selection (Published)
- Borrelia pan-genomics (Submitted)
- Positive and negative selection in Borrelia ORFs and IGS (In submission)
- Dr Bargonetti's project (Summer 2013)
- A new pipeline using MUGSY-FastTree (Summer 2013)
- Borrelia Genome Database & Browser (Summer 2013)
- Pseudomonas population genomics (Summer 2013)
- Hypothesis Testing: Do host-interacting genes show adaptive codon usage? (Summer 2013): Project page
- Frequency distribution of ospC types in wild tick populations (Fall 2013)
Lab meeting: May 16, 2013
- Weigang: IGS paper submitted yet?
- Che: Thesis update. Chapter 3. Evolution of ospA/ospB gene family
- Pedro/Zhenmao: Can we wrap up the BLAST identification of ospC types?
- Girish: Fetch cp26 sequences from DB; Run MUGSY & FastTree
- Saymon/Deidre: Identification of consensus start-codon positions
- Pedro/Girish: orth_get/orth_igs website development. Catalyst. Implement graphics (genome map & phylogeny) query interface
- Raymond: start the Pseudomonas summer project
Foundational Readings
- Molecular phylogenetics
- Population genetics
- Genomics
- Systems Biology
Informatics Architecture
- Operating Systems: Linux OS/Ubuntu, Mac OS
- Programming languages: BASH, Perl/BioPerl, R
- Relational Databases: PostgreSQL
- Software architecture
- bb2: Borrelia Genome Database
- bb2i: an Perl API for bb2
- DNATweezer: Perl wrappers of most frequently used BioPerl modules, including Bio::Seq, Bio::SimpleAlign, and Bio::Tree [1]
- SimBac: A Perl/Moose package for simulating bacterial genome evolution [2]
- Borrelia Ortholog Retriever: Download ortholog alignments from 23 Borrelia spp genomes. Search by gene names and IDs.[3]
- Hardware Setup
- NSF File Server
- Database and Application Server
- Web Server
- Linux Workstations
Perl Challenges
| Problem | Input | Output |
|---|---|---|
| DNA transcription | A DNA sequence, in 5'-3' direction (e.g., aaatttaaaagacaaaaagactgctctaagtcttgaaaatttggttttcaaagatgat) | An RNA sequence, in 5'-3' direction |
| Genetic code | None | 64 codons, one per line (using loops) |
| Random sequence 1 | None | Generate a random DNA sequence (e.g., 1000 bases) with equal base frequencies |
| Random sequence 2 | None | Generate a random DNA sequence with biased base frequencies, e.g., 10% G, 10% C, 40% T, and 40% A. |
| Graphics I | a categorical dataset, e.g., Biology | a bar graph & a pie char, using GD::Simple or Postscript::Simple |