Qiu Lab Meetings

Projects & Goals

Borrelia population genomics: Recombination & Natural Selection (Published)
Borrelia pan-genomics (Submitted)
Positive and negative selection in Borrelia ORFs and IGS (In submission)
Dr Bargonetti's project (Summer 2013)
A population genomics pipeline using MUGSY-FastTree (Summer 2013)
Borrelia Genome Database & Browser (Summer 2013) Version 2 screen shot
Pseudomonas population genomics (Summer 2013)
Hypothesis Testing: Do host-interacting genes show adaptive codon usage? (Summer 2013): Project page
Phylogenomics browsing with JavaScript/JQuery, Ajax, and jsPhylosvg
Frequency distribution of ospC types in wild tick populations (Fall 2013)

May 24, Friday: End of School Year Party in the Park (we leave from Hunter @ 1:30pm)
Recommended reading of the week: Detecting Neanderthal genes using the D' homoplasy statistic
Weigang: IGS paper submission
Che: Thesis update/SILAC project/Summer teaching
Zhenmao: Manuscript update: Material & Methods; Results (Tables and Figures)
Pedro: Catlyst web framework
Girish: cp26 phylogenomic analysis
Saymon and Deidre: consensus start-codons

Weigang: IGS paper submitted yet?
Che: Thesis update. Chapter 3. Evolution of ospA/ospB gene family
Pedro/Zhenmao: Can we wrap up the BLAST identification of ospC types?
Girish: Fetch cp26 sequences from DB; Run MUGSY & FastTree
Saymon/Deidre: Identification of consensus start-codon positions
Pedro/Girish: orth_get/orth_igs website development. Catalyst. Implement graphics (genome map & phylogeny) query interface
Raymond: start the Pseudomonas summer project

Operating Systems: Linux OS/Ubuntu, Mac OS
Programming languages: BASH, Perl/BioPerl, R
Relational Databases: PostgreSQL
Software architecture
- bb2: Borrelia Genome Database
- bb2i: an Perl API for bb2
- DNATweezer: Perl wrappers of most frequently used BioPerl modules, including Bio::Seq, Bio::SimpleAlign, and Bio::Tree [1]
- SimBac: A Perl/Moose package for simulating bacterial genome evolution [2]
- Borrelia Ortholog Retriever: Download ortholog alignments from 23 Borrelia spp genomes. Search by gene names and IDs.[3]
Hardware Setup
- NSF File Server
- Database and Application Server
- Web Server
- Linux Workstations

Problem	Input	Output
DNA transcription	A DNA sequence, in 5'-3' direction (e.g., aaatttaaaagacaaaaagactgctctaagtcttgaaaatttggttttcaaagatgat)	An RNA sequence, in 5'-3' direction
Genetic code	None	64 codons, one per line (using loops)
Random sequence 1	None	Generate a random DNA sequence (e.g., 1000 bases) with equal base frequencies
Random sequence 2	None	Generate a random DNA sequence with biased base frequencies, e.g., 10% G, 10% C, 40% T, and 40% A.
Graphics I	a categorical dataset, e.g., Biology	a bar graph & a pie char, using GD::Simple or Postscript::Simple