FlhF unique align: Revision history

Jump to navigation Jump to search

Diff selection: Mark the radio buttons of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

16 July 2013

  • curprev 17:1517:15, 16 July 2013imported>Rayrah 21,347 bytes +21,347 Created page with "<pre> CLUSTAL W (1.81) multiple sequence alignment Pstutzeri_DSM10701_flhf atgcaggtcaaacgtttcttcgctgccgacatgcggatcgccatgaaaatggtgcgtgac Pputida_GB-1_flhf atgcaagttaagc..."