Revision as of 04:07, 1 June 2014

Summer 2014

Name	Goal/Description	Team
Pseudomonas	Gene gain/loss SNP analysis	Example
Borrelia intergenics	Clean up start-codon positions	Example
SNP pipeline	Example	Example
Gain/Loss pipeline	Example	Example

Frequency distribution of ospC types in wild tick populations (Fall 2013) Project page
Mutual information

Borrelia population genomics: Recombination & Natural Selection (Published)
Borrelia pan-genomics (Submitted as of 5/25/2013)
Positive and negative selection in Borrelia ORFs and IGS (Submitted as of 6/15/2013)
Dr Bargonetti's project (Summer 2013)
A population genomics pipeline using MUGSY-FastTree (Summer 2013): Project page
Borrelia Genome Database & Browser (Summer 2013) Version 2 screen shot
Pseudomonas population genomics (Summer 2013) Project page
Hypothesis Testing: Do host-interacting genes show adaptive codon usage? (Summer 2013): Project page
Phylogenomics browsing with JavaScript/JQuery, Ajax, and jsPhylosvg
Frequency distribution of ospC types in wild tick populations (Fall 2013) Project page

May 24, Friday: End of School Year Party in the Park (we leave from Hunter @ 1:30pm)
Recommended reading of the week: Detecting Neanderthal genes using the D' homoplasy statistic
Weigang: IGS paper submission
Che: Thesis update/SILAC project/Summer teaching
Zhenmao: Manuscript update: Material & Methods; Results (Tables and Figures)
Pedro: Catlyst web framework
Girish: cp26 phylogenomic analysis
Saymon and Deidre: consensus start-codons

Weigang: IGS paper submitted yet?
Che: Thesis update. Chapter 3. Evolution of ospA/ospB gene family
Pedro/Zhenmao: Can we wrap up the BLAST identification of ospC types?
Girish: Fetch cp26 sequences from DB; Run MUGSY & FastTree
Saymon/Deidre: Identification of consensus start-codon positions
Pedro/Girish: orth_get/orth_igs website development. Catalyst. Implement graphics (genome map & phylogeny) query interface
Raymond: start the Pseudomonas summer project

Problem	Input	Output
DNA transcription	A DNA sequence, in 5'-3' direction (e.g., aaatttaaaagacaaaaagactgctctaagtcttgaaaatttggttttcaaagatgat)	An RNA sequence, in 5'-3' direction
Genetic code	None	64 codons, one per line (using loops)
Count amino acids	A protein sequence	Frequency counts of individual amino acids
Count codons	A protein-coding DNA sequence	Frequency counts of individual codons
Random sequence 1	None	Generate a random DNA sequence (e.g., 1000 bases) with equal base frequencies
Random sequence 2	None	Generate a random DNA sequence with biased base frequencies, e.g., 10% G, 10% C, 40% T, and 40% A.
Graphics I	a categorical dataset, e.g., Biology	a bar graph & a pie char, using GD::Simple or Postscript::Simple

@@ Line 1: / Line 1: @@
 =Summer 2014=
+==Projects & Goals==
+{| class="wikitable"
+|-
+! Name !! Goal/Description !! Team
+|-
+| Pseudomonas ||
+* Gene gain/loss
+* SNP analysis
+ || Example
+|-
+| Borrelia intergenics || Clean up start-codon positions  || Example
+|-
+| SNP pipeline || Example || Example
+|-
+| Gain/Loss pipeline || Example || Example
+|}
+* Frequency distribution of ospC types in wild tick populations (Fall 2013) [[strain_natural_frequency|Project page]]
+* Mutual information
 =Summer 2013=