Qiu Lab Meetings

School Year 2015

Sept 4, 2015

• Journal Club: a nice review of bacterial population genetics (E.coli model), from protein polymorphisms to whole-genome variations. [1]. Presenter: Amanda
  • Technological history of bacterial population genetics: MLEE -> MLST -> Whole-genome
  • Key terms & concepts: clonality, linkage disequilibrium, recombination, homoplasy, r/m ratio
  • Methods for recombination detection: clustered polymorphism, homoplasy (phylogenetic inconsistency)
  • Tools to try: recHMM (detecting homoplatic sites, fine-grained), PHI (per gene detection, coarse), USEARCH (alternative to BLAST)/UCLUST (alternative to CD-HIT), Distance method (? no reference given; can't understand algorithm either)
  • My rating: 4.8/5 (concise, thoughtful & solid review, covering a vast range of history, species, and theory; no apparent theoretical or visual flaws; ending a little pessimistic; implications to the greater biomedical audience is not explored)

Aug 28, 2015

• Journal Club (12:30-1:30): an recent paper claiming wide-spread gene loss & pseudogenization in bacterial pathogens. [2]. Presenter: Roy
  • Key terms/concepts: pan-genome, pan-genes (core/"near core"/rare), normalized identity (NI), genomic fluidity, pseudogene conservation percent (PCP), AAI (aa identity), effective population size (Ne), Muller's Ratchet
  • Key methods: FASTA for ortholog/paralog identification, PHI (pairwise homoplasy index) for detecting recombination, TFASTA for HGT (gene gain), RAST for gene calls and genome annotation
  • Key findings: bi-modal distribution of pangenes; two clonal species has high genomic fluidity, despite being closely related; little HGT ("rare") but lots of losses ("near core") in clonal species; maintenance of pseudogenes (small Ne)
  • Pluses: large number of genomes; results broadly convincing; rigorous interpretations and discussion
  • Flaws: No phylogenetic reconstruction; no synteny verification; no gene function analysis; no statistical evaluation of the conclusion; bad presentation (figures should be tables and tables should be figures)
  • My overall rating: 3.5/5.0
• Project updates & plans (1:30-2)
  • Weigang: design statistical tests for 2 hypotheses: (1) any co-occurrence of oc types? (2) lineage-stabilizing genes
  • Saymon: tick-bacteria gene transfer positive; pcr is working for positive controls; need to start testing for nymphs
  • John & Rayyes: pa2 database cleaning nearly done; start polymorphism-by-genome-location analysis
  • Amanda & Roy: Treponema project has a working database, pipeline, and preliminary validated results; start documenting protocals, tabulating results, and prepare functional analysis

Sept 11, 2015

• Journal Club: an in-depth analysis of Staphylococcus aureus genomes. [3] Presenter: John

Sept 18, 2015

• Journal Club: latest statistics in detecting population admixture and genome intragression (d3, f4, h4, ChromosomePainter).[4]. Presenter: Saymon

Summer 2014

Projects & Goals

Name	Goal/Description	Team
Pseudomonas	Gene gain/loss SNP analysis	Example
Borrelia intergenics	Clean up start-codon positions	Example
SNP pipeline	Example	Example
Gain/Loss pipeline	Example	Example

• Frequency distribution of ospC types in wild tick populations (Fall 2013) Project page
• Mutual information

Summer 2013

Projects & Goals

• Borrelia population genomics: Recombination & Natural Selection (Published)
• Borrelia pan-genomics (Submitted as of 5/25/2013)
• Positive and negative selection in Borrelia ORFs and IGS (Submitted as of 6/15/2013)
• Dr Bargonetti's project (Summer 2013)
• A population genomics pipeline using MUGSY-FastTree (Summer 2013): Project page
• Borrelia Genome Database & Browser (Summer 2013) Version 2 screen shot
• Pseudomonas population genomics (Summer 2013) Project page
• Hypothesis Testing: Do host-interacting genes show adaptive codon usage? (Summer 2013): Project page
• Phylogenomics browsing with JavaScript/JQuery, Ajax, and jsPhylosvg
• Frequency distribution of ospC types in wild tick populations (Fall 2013) Project page

---

Lab meeting: June 13, 2013

• Weigang: IGS paper submission should be done by Thursday.
• Che/Slav: Workshop update (Meeting at 3:30pm?)
• Che: SILAC project (Meeting at 4pm?)
• Zhenmao: Tick processing & paired-end Illumina sequencing
• Pedro: Updates on "ncbi-orf" table
• Girish: phyloSVG extension; QuBi video
• Saymon and Deidre: consensus start-codons
• Reeyes and Raymond: Pseudomonas DB; fleN alignment and phylogeny
• Valentyna: BLASTn results (4:30pm?)

Lab meeting: May 23, 2013

• May 24, Friday: End of School Year Party in the Park (we leave from Hunter @ 1:30pm)
• Recommended reading of the week: Detecting Neanderthal genes using the D' homoplasy statistic
• Weigang: IGS paper submission
• Che: Thesis update/SILAC project/Summer teaching
• Zhenmao: Manuscript update: Material & Methods; Results (Tables and Figures)
• Pedro: Catlyst web framework
• Girish: cp26 phylogenomic analysis
• Saymon and Deidre: consensus start-codons

---

Lab meeting: May 16, 2013

• Weigang: IGS paper submitted yet?
• Che: Thesis update. Chapter 3. Evolution of ospA/ospB gene family
• Pedro/Zhenmao: Can we wrap up the BLAST identification of ospC types?
• Girish: Fetch cp26 sequences from DB; Run MUGSY & FastTree
• Saymon/Deidre: Identification of consensus start-codon positions
• Pedro/Girish: orth_get/orth_igs website development. Catalyst. Implement graphics (genome map & phylogeny) query interface
• Raymond: start the Pseudomonas summer project

---

Foundational papers for working in Qiu Lab

• A recent review by Qiu lab: Evolutionary genomics of Lyme bacteria
• Phylogeography of Borrelia burgdorferi sensu lato. A review by Margos et al. 2011
• A short tutorial on molecular phylogenetics: Phylogeny for the faint of heart: a tutorial
• The Ka/Ks test of natural selection: The Ka/Ks ratio: diagnosing the form of sequence evolution

---

Informatics Architecture

• Operating Systems: Linux OS/Ubuntu, Mac OS
• Programming languages: BASH, Perl/BioPerl, R
• Relational Databases: PostgreSQL
• Software architecture
  • bb3: Borrelia Genome Database. To access: psql -h borreliabase.org -U lab bb3
  • Pseudomonas Genome Database. To access: psql -h ortholog -U lab paerug
  • DNATweezer: Perl wrappers of most frequently used BioPerl modules, including Bio::Seq, Bio::SimpleAlign, and Bio::Tree [5]
  • SimBac: A Perl/Moose package for simulating bacterial genome evolution [6]
  • BorreliaBase

---

Perl Challenges

Problem	Input	Output
DNA transcription	A DNA sequence, in 5'-3' direction (e.g., aaatttaaaagacaaaaagactgctctaagtcttgaaaatttggttttcaaagatgat)	An RNA sequence, in 5'-3' direction
Genetic code	None	64 codons, one per line (using loops)
Count amino acids	A protein sequence	Frequency counts of individual amino acids
Count codons	A protein-coding DNA sequence	Frequency counts of individual codons
Random sequence 1	None	Generate a random DNA sequence (e.g., 1000 bases) with equal base frequencies
Random sequence 2	None	Generate a random DNA sequence with biased base frequencies, e.g., 10% G, 10% C, 40% T, and 40% A.
Graphics I	a categorical dataset, e.g., Biology	a bar graph & a pie char, using GD::Simple or Postscript::Simple