Qiu Lab Meetings

From QiuLab
Revision as of 09:41, 27 August 2015 by imported>Weigang (→‎Sept 11, 2015)
Jump to navigation Jump to search

School Year 2015

Aug 28, 2015

  • Journal Club: an recent paper claiming wide-spread gene loss & pseudogenization in bacterial pathogens. [1]. Presenter: Roy

Sept 4, 2015

  • Journal Club: a nice review of bacterial population genetics (E.coli model), from protein polymorphisms to whole-genome variations. [2]. Presenter: Amanda

Sept 11, 2015

  • Journal Club: an in-depth analysis of Staphylococcus aureus genomes. [3] Presenter: John

Sept 18, 2015

  • Journal Club: latest statistics in detecting population admixture and genome intragression (d3, f4, h4, ChromosomePainter).

[4]. Presenter: Saymon

Summer 2014

Projects & Goals

Name Goal/Description Team
Pseudomonas
  • Gene gain/loss
  • SNP analysis
Example
Borrelia intergenics Clean up start-codon positions Example
SNP pipeline Example Example
Gain/Loss pipeline Example Example
  • Frequency distribution of ospC types in wild tick populations (Fall 2013) Project page
  • Mutual information

Summer 2013

Projects & Goals

  • Borrelia population genomics: Recombination & Natural Selection (Published)
  • Borrelia pan-genomics (Submitted as of 5/25/2013)
  • Positive and negative selection in Borrelia ORFs and IGS (Submitted as of 6/15/2013)
  • Dr Bargonetti's project (Summer 2013)
  • A population genomics pipeline using MUGSY-FastTree (Summer 2013): Project page
  • Borrelia Genome Database & Browser (Summer 2013) Version 2 screen shot
  • Pseudomonas population genomics (Summer 2013) Project page
  • Hypothesis Testing: Do host-interacting genes show adaptive codon usage? (Summer 2013): Project page
  • Phylogenomics browsing with JavaScript/JQuery, Ajax, and jsPhylosvg
  • Frequency distribution of ospC types in wild tick populations (Fall 2013) Project page

Lab meeting: June 13, 2013

  • Weigang: IGS paper submission should be done by Thursday.
  • Che/Slav: Workshop update (Meeting at 3:30pm?)
  • Che: SILAC project (Meeting at 4pm?)
  • Zhenmao: Tick processing & paired-end Illumina sequencing
  • Pedro: Updates on "ncbi-orf" table
  • Girish: phyloSVG extension; QuBi video
  • Saymon and Deidre: consensus start-codons
  • Reeyes and Raymond: Pseudomonas DB; fleN alignment and phylogeny
  • Valentyna: BLASTn results (4:30pm?)

Lab meeting: May 23, 2013

  • May 24, Friday: End of School Year Party in the Park (we leave from Hunter @ 1:30pm)
  • Recommended reading of the week: Detecting Neanderthal genes using the D' homoplasy statistic
  • Weigang: IGS paper submission
  • Che: Thesis update/SILAC project/Summer teaching
  • Zhenmao: Manuscript update: Material & Methods; Results (Tables and Figures)
  • Pedro: Catlyst web framework
  • Girish: cp26 phylogenomic analysis
  • Saymon and Deidre: consensus start-codons

Lab meeting: May 16, 2013

  • Weigang: IGS paper submitted yet?
  • Che: Thesis update. Chapter 3. Evolution of ospA/ospB gene family
  • Pedro/Zhenmao: Can we wrap up the BLAST identification of ospC types?
  • Girish: Fetch cp26 sequences from DB; Run MUGSY & FastTree
  • Saymon/Deidre: Identification of consensus start-codon positions
  • Pedro/Girish: orth_get/orth_igs website development. Catalyst. Implement graphics (genome map & phylogeny) query interface
  • Raymond: start the Pseudomonas summer project

Foundational papers for working in Qiu Lab


Informatics Architecture

  • Operating Systems: Linux OS/Ubuntu, Mac OS
  • Programming languages: BASH, Perl/BioPerl, R
  • Relational Databases: PostgreSQL
  • Software architecture
    • bb3: Borrelia Genome Database. To access: psql -h borreliabase.org -U lab bb3
    • Pseudomonas Genome Database. To access: psql -h ortholog -U lab paerug
    • DNATweezer: Perl wrappers of most frequently used BioPerl modules, including Bio::Seq, Bio::SimpleAlign, and Bio::Tree [5]
    • SimBac: A Perl/Moose package for simulating bacterial genome evolution [6]
    • BorreliaBase

Perl Challenges

Problem Input Output
DNA transcription A DNA sequence, in 5'-3' direction (e.g., aaatttaaaagacaaaaagactgctctaagtcttgaaaatttggttttcaaagatgat) An RNA sequence, in 5'-3' direction
Genetic code None 64 codons, one per line (using loops)
Count amino acids A protein sequence Frequency counts of individual amino acids
Count codons A protein-coding DNA sequence Frequency counts of individual codons
Random sequence 1 None Generate a random DNA sequence (e.g., 1000 bases) with equal base frequencies
Random sequence 2 None Generate a random DNA sequence with biased base frequencies, e.g., 10% G, 10% C, 40% T, and 40% A.
Graphics I a categorical dataset, e.g., Biology a bar graph & a pie char, using GD::Simple or Postscript::Simple